Description :
From Genome Similarity Track
Location :
Scaffold_1170:550- 2078
Transcript NameFunction/comments
Physo_145412hypothetical protein

Sequence
1528 bases(100 bases per row)
GTCAAGTAGTCCGCGGCCTGGTTGTATTCACGCTTGACGTGTACCAGTCCGACTGTCCTGAATTTCTCCTTGAGCACATGACATTCGGCGAGCCTCCGCT
GCAGGGGAGGCTGGTTGCAGTTGATGAGTCCTTGTACCTGCTGAATGACGATCCTTGAGTCACCCACGACCACCAGGTCCGCGATGTCCCGCTGGAGCGC
CATGGTCATGCCTTTCAGTAGTCCATAGTACTCCGCGTTGACTGTCACTCCATCCAGGGTGTAGCCGCGAGCCTCGATGACAGTCCATTCGGGAAGCTGC
CACAGTATACACCCGCAACTTCCTTGTTTCGTGGACGTCTTAGCTGCGCCATCGAAACTCAGTGCGACTCCCGAATAGTCTGGCTCCAACATCTCCACAC
TCACCACAGGCGGCGCCTTCACTCGCCCCTTGGCCGGGATCAGCGATTCGGCCACTTCATCTAGATGCTCTCTGGGCGTGATACCCGCACCCAGGATGGC
GGCCAATCCGTCCTCGTCCCTTTGCTATTTCCGGATGTTCAGGTCGTAATGTGATAGGGCAACGCCCCAAGGCACCGTGCGACCATCCGCGGTTTTCGAC
TTGATCACCCACTTCAGGACGGAGTACCTGGTATACACAACCAGCGGGCATCCTTTGACCAGGGCCTTGAACACTTGGAGTACCCGGATGACCGCGAGCA
CTTCCTTTTCGGCGATGTGATACCGGAGGTCGGCATCATTCCGGACACGCCCCGTGAAACGTACAGGTTGGATCACGCCATCATACTCCTGTCCGAGGAC
AGCACATGCCACCCACTGATTTGCATGCGGGATGATCACAAACGGCTTAGTCCGGTCCGGGTGTCTGAGCATCGGTGTGGATACAATCTTTCTTTTCAGG
ATGTCGATCGCCTCCTTCGCCCGAGTCAGATCTCGACCGTCCCGCACTTGATCGTCCGTTAACTCATACAGCACCACAGCGACCACTGGAAAGTCTTCAA
TGAACTTGTGGTAATAATTCAGGCTTCCCAGAAAAGATTGGATCCCTTTCAGGGTCTTCGGGAACGGCGAGTCCTGGATACCCTTCACAATCTTTGGAGT
CGCTCGAATCCCTTCAGCTCCGATCTCATGAGACAGGTACGGAATGGTCCGCTTCCCGAATTCACTCTTGGGCAGACTGAACGAAATGTTCCAGTACCTC
AGTCGGTACAACAGCGCGTTCAGGTGGTCACACAATTGGTCCCAAGTGGTGGCTCCATGTGCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTC