Description :
From Genome Similarity Track
Location :
Scaffold_33:550- 1743
Sequence
1193 bases(100 bases per row)
CAGGCCGCATTTGTAAGAGCTCGGCGATGCTATTTTCCACACACTTTCTAAAGTAGAGACGATAGTATTTTTAATATTAAAGTAGACTTCACGACCAGCG
CTTTTTGTAGCGACTTTGCGAATATATATATTTTTGTACTTTACCTGGAAATCACCACTGCCACCGTGCAATGAAGGCGCGCAGCTGCACGGGCATTTCG
CTATCTGCTCCCGTGCACCACACCCGACAGATGCATGCGCGCACGATAGATAATTGTCTTAGGCAATTTATATTGCATGTAAGGTATGTTTTTGTTTGGA
AATCTGATAATAATATATTATAGCAAAGCCAAAACGTTAGTATTAACTTTTTAATATGTTTCTAAATAATAAATACCAGTCTTATATTTCCAAGCTATTG
GCTAATATTTGGACGCAAGTAATTGGTTAAAACAAAATATTTTGCTAACATCCGCACGTTTGCAAAATGGTGGGCCCTACGTGCAAGCAATGCGAGGCGA
AGATTGACCCGCTTCTGCTGAACCCGCAGCGGTCTACGACGGATCCCCGAGCGCGCTGCGTCTGCTGCGGGAAGCTGCAGTACGGCTACGCATTTCGTAC
AATCAGCGGGCGGGACATCGTGCGGCGCTGTATGCCTGCGAGAACGGCCCAAAAGCGAATGATTTCTGGGAGAAAAGGCCCCCACAACCTGAGTCGGCCG
AAGGGTGCCGCCAGGAAAGCCTGGCGAACGTCAAGAAAGCGATGGGTCCTGACTGGTACCCCAAGAAGAAAAAGAGGCGCAGCCACCCTCGCAAGCTGAC
CGCCCGTACATCGAGCAAAAGAAGCAGCAGAAGAGCAAGTAATTGGTAAGTATACCCTTTTAGACCTTTTCCTACCTATTTTTGTATTTAGTATACTGAG
TGACGGTGCGGGGTTTGGGGCCGCACATACGGTAAGCTGACTATGGTGTTCACGCACCTACAGAGCGTAGCGCGCTTAAAAAAATAATTTAGACATGGAA
TCAACTGTGCACCGCTGCAAGTTGGGTGGCTCCTATCCGCATACGCGTCACCGTAGATGGCATGTACACTCGCTCACGTGGGCACACGCAAAACCATGCT
ATCTGTACCACCAACGCTCACAGCGCATATTTCATTAATGTGCGCTCACGAGTGTAAGCTTCAGTATAGAGTGAGCACTATGCACCGACCAAT