Description :
From Genome Similarity Track
Location :
Scaffold_3148:550- 1598
Transcript NameFunction/comments
Phyta_totarag15102hypothetical protein PHYSODRAFT_341739

Sequence
1048 bases(100 bases per row)
GTAGTAGGCGCATTAATCACAGTCACATATCTTCCAGTGCGATTCGTTCTTGAGTTGGTCCACTAGGATATCAACCACATCCATCGCGTACGATAGACGA
AGCGCCACGTTGTATCTCTTCTGCCAATTCAGGCCTTCTTGCCAATGACGCACAAGAGCGTCGTACGTAACGGATGGATCAGCCTCCATGCTCGACGTGT
TCATCTTGCTTGACACGCTGTTGTTCCAAGCAACACTCATAAAACTTCATTCGTGCGCGAATTTGTGATCTATCAATCTGAATTCTCAGCACAATAGGCA
TCAGCAAAGACAAATACAATAGTTTCGACAGGATCGTGCCTTACCTCCGATAGCTCCATACACGTGCGCAGCCAGCGCATCATCCAGAAAAAGTTGTGGA
CGCATTCCTCTTTACCCTTGAAGCAGATTGCCTGGTAAAGATCATGCATCTCTTTCACTGGTAGTGCTGCGATAAAGTCGTCCACGTCTCCAGACGACCC
GAACAGAGATTCGGTTGTCTACAGCACCAGATTGAAGTCGTTAGCTTGCGATATCATCGATGATAACTCACCCGCTCATTTGCAGTTACAAACACGGGAT
AAATCTCGTCGAACTCGACCCTCTCACCAGCGCTAAAGAAAGAAAGGGGCTACAGACACGATAAGTATAAAAAAACAAATAAATTACGATTGATGCCCTT
ACATCATCGATGCTGTGAGCCGCGTAAATGCTTTGTCCTTTGTTTGCATGAGTCTTCGTCGGATGTAGCACCTAGTGTCGTGTGTAAACAGAATATGAAG
TACCCACAACAATGTCTGGCAAAACAGAGACTTACCTCAATGGTATCCGCGTCACGACGGCGATCAACCATCTGATCCCTAGATGGCAAATGCGCAACTT
CTCTAGAAGGCCGCGCTCGAATGACTGAAGAGTTGGATGTGGACCAAACATCTCGAGCTGTGTATGATGAAGGATCCGGTGCATAGCTGTCGATCAACAG
CGACTCGTAGGAGACCATGGGACCAAACGTGCTATAATTTGTATACCT