Description :
From Genome Similarity Track
Location :
Scaffold_2116:55- 3163
Sequence
3108 bases(100 bases per row)
GTACTCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTG
GATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGT
CGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTA
AACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAG
GACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAGGGTCTCTAGTTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTC
TCTTCAACCCTGGATCTACAAAAGGGAGAGGCACGTGGTTACTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAG
ATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCA
TGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTG
GATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACAAACGGGAGAA
CGCGAATTAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCAT
GGTGCCAGCTGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCG
AAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTGAAGTGGGTGGAACATGAGAAACTGT
GGGTCACTCGGGGCGAGAAATGGGTACCTACAAATGGGTACCTACCGTAGTCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGAC
AAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGGCGAAGGACCGTATTCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCT
ACAGAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCG
GCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGT
CGGCCCTTAGATAACGCAGGGTCGGTGGACGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCCGATCCACAAGTGGATCCAAGCTTTCCAC
TGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGACAAACCTGAACCGTCGGGTTTAGACTCGTTAGAGGACCGGCTGGATCCGACAGGTGA
CTTCTCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACC
GAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGTATGGCGGTAATCCCGGAGGTACCACTGACCACCGAGG
AGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGAT
CGGTAAGGGTAATGCGTTACCGCCCGCCGCCCACGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCA
CCTCAGTTCCGAAAAAAACTGTCGGATCTGATTAAGGGCTTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAATCA
TCATCAAGAAGACGGGGTGTATATACGTCTGTGCATTGATTACGCGCGTGTTTACACACCCGCCCTCACTGATGTGGTGGTATATCCAATGCCTCTGATC
AATGAGCTGTTGGAAGATTTGGATAAAGCACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAA
TATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGC
CCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAACCAGAATCCTGG
GACCGCGTTCTGTGTTGAGGAAGACGAATCTTAACTTGCGAGGACATTTATGATCCCGGGCGAATTCTTGAGAATACAGTTGTGGCGAAGAGAGTGACCT
TCCTAACGGGAGGCGTGTAACTGAGTGAGAAATCTTCTCTTTCCAGCGTGGTTAAGAGACCTTTGGGGGAGATGCGCCAGGGTGAATTACTTGGGCCATC
GAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGG
CAGTTTGAACTACTACAGTCGGTTCATCGAAGATTACGCCTTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCA
GCTGTCCG