Description :
From Genome Similarity Track
Location :
Scaffold_724:55- 2634
Sequence
2579 bases(100 bases per row)
TGGCCTCCGCTTTCCTGTCGCCTCGGGGGAAGATAGGAGTTTGAACTCACGTGAGCTTGTTTCATGCTGAATCTTCTTGTTCCGCAACTCAGATTGCCTC
TTCCAGGGTATAAAATTCCAACCGGAAGAGCTAGGTCCTGGATGGACCGTCTGTGAGACCGTGCATGAACAACGTGATCAACGTTTGTTCATTCGTTGGA
TTGGACGTGATACAACTCGTAAGATGACGTATGTACTGAATGTACGAATGTACATAACATTTGCCTTGTTTGAGTTTCAGGGGTTCATAGCGAGCCCTGA
ACTCAGCTCGCGGTGGTTCGAATGTTTGCCTAAGCAGGTACTTGAAGACTTCTAACGACCCAAAGACAAATGAATCGTGTAGCTTGAGGCCCAAGGCCCA
AGTCTTCGCACGCCCTTCCAAGTTTGACTGAGCAATGCGACCATTTGCCCCAACGCTTCGCACACCCTGCCAAGTTCGACTGAGCAAATGCGCTATTAAG
TGTCGCAGCTTTCAGTTTTGGCACAAGCAGCACAAACGAGTCAAAACTCGTAATTTTTATCCAGCCAGCCGCTACGCTTAAGCAACGTGTTCGCGTTCTT
AGCTCGTACATGTAAGCAGGATCACCCGAAGGACTCGCAAACTCACCGCAAACATAATTTGCCTATTTCGTGAAGTGATGTCGGCACACATGACGCCGAA
CCAACTCGTCGCTCGTTTTGTTGCAGTCCTTTTCTTCACAAGCCTTCGCGTGTGAGCTCCTTGTCGATCTTATGCGGAAAAAAACATCGTCCTCAACCGT
ATACTACATATTGCACAGCCTGTGGTGTAGCAAAGACGGTGCTAAGACGTGCGTATGCTACGCGTTCCATCAAGGAGCTACTGGTAACTAACCCTTTTAG
AAAGAAAAAGGAGAGAGGTATCGGGTTAAGCCCCATCACGCCACAACCAGTGTCGTGATTGTGCCGTTCAGTAAGAGCACAACCCCTACGCTAGACTCTT
ATGGTATCTGTGGAGAAACGTGTGGATACGGACTCGGTACGCTTGATTGATTGAGCAGAGGTTGCTGCACGATATCGAAAGACGTCTCCCTTATTGCAGC
TGATACACCTTAGCAAATGACTTATGTACAACAGATAGACTCCTCGAGCGTCCTGCCGCCACGACTGAACCGCTCAACTATCTACACCACTATTTACTGG
CTGAGAAGCCATCTGTTAGTACAGCATCTAGAATTTTGCCACGTCTACTTTCCAGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN