Description :
From Genome Similarity Track
Location :
Scaffold_312:55- 2557
Transcript NameFunction/comments
Aphas_H257_19341pol protein putative
Aphas_H257_19342pol protein

Sequence
2502 bases(100 bases per row)
GCTCTTCTCATCGCTTAGCGAATGATCTTGAGGATGTTGAGCGCCGCGTTGGTTGGCTCGAGTCGCCCCAGGCGATGCAACATCGGGTCTCGGACCTCGA
GCGTCAAGTTGCTCAACTACAGGGTCAACTTGACCTGTTAGTCCGGATGCAGCCGTACGGCTCTCACCCTGTGGCAATGCCACCCCCAATGGCTCTGCAG
CTTCCTGCCGCCCCGCAGTATCCTGCGTACCCGACCTCTGGTGCTGGGCGTCAGCATCTTGCTGCCTCGCAGCCTCCTGCTGCTTCGCAACCTCTCGCTG
CTTTGCAGCCCTCATCCGACCCGGCGCTAGCGTCTCAGGGCTCACCCGAGCAGGGTCCCGGTAGGGCTTGAGCAAGCCAACATAAAACACCGGGTGCGTA
CGCATCTTCTTTGGAAGATTGAGCGTGTACGCTAGGCCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGAAGCAGCCCGACGTGCTGCCCTGCAGCCGCTTGACACATACACGTGTGGGCCTGC
GGCCAGAACGACGGACGAAGTCGTTAAACGACAGACGCTCCGTGAGCGATACTTGACTCCGCAAGTTACTACTCCTGCTGAGTATCGCGAACGGTTACGC
CAGCAGCTCAGGGGTGAGCCGGTACCTGCGATGCAGACTGTACCCGTGGTCCTCGCAGCGGGTGAAACCACCAATGCTTATGAAGCGCAGTTTCAAAACT
GGGTGGAGTTAGCTCGACGGCTTCACTCCTTTGATGCTCTCCGAGCTAGTTTCTCGGAAACAGATATCCGCTTAGAGCGGCGCTTGCGCTTCGACTTCGC
GAAACGTCAAGCCAAGCGACGTACTTCAGGACAACGTCCCTCTCGTTACGAGGCATCCCCGCCTCCTGCTCCTGCTGTAGACAGCCCTGCTCATGATCAC
GAGCCGGCTGCTACAGCCACTGGTCAAAGCCCGAGCCCGGCTATTGACCTGTCGTCGCCCCATTCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN