Description :
From Genome Similarity Track
Location :
Scaffold_2052:55- 2305
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2052-snap-gene-0.3DnaJ (Hsp40) homolog, subfamily C, member 13

Sequence
2250 bases(100 bases per row)
TGTTCCGTCGAATAGAATTATAGCTGTTTCGCCGAGACAAAATGCCATTTTGCCGTCCGGAGAGCACATTGTTTCCTCGATTGCTGCTGATACCGTAGTT
CATGTTTTCTCCGAAAGTCAATGAATGATGCGGAACTTGCTGTCTGCGAGAGCTGCCCAGATGACTTCCACCAAATTGTGCAAAGTACGGGTTGTTTGTC
ATTCTGCTGAGGAGACCAACACATGATTCGACAGTAATGAGACTCGGAAATCCGAACAGGATACGCTGAAGCATTCGATATTTCGTCGCCAAGTTCTGGT
AGAAATTCAGCGAGAGCTTCTCGTGCTTTGTAACGTTCGTTTTCACCAGGGATAAAACCAATTGACTGAGCATCATAGTTGGGAGCTCCGATAAATACTT
CTGAGTCTAGAAAGCAACGATAAGTTAGACCAAAACAAGTTATGTAGCCAGCTTCGGTTTCGTCTTACCAGGGCATCTTCATCAAATAGCGCCAATAGCT
TTTGCTGAAAAATGTTGCTTGATAGCAACACTTCGATGCACTGGGTTTGGTGTGTTTTGGACTCTATCAGGCGATGCAGGACTCTCAGCATCCAGTAAGT
CGGTACTGGGCTCCGACAGGATAATATTTGAGTGATCGTTCCGATGTACTCATCTCCGCGCTGTGGCACAAAATGTTAGTAAGATATACGAGAAGATATT
GAGCAAGTACGTAGTAATGCTTACCTCGACTAGGATCCGCACAAACTCTTTCATAGCTGACGGCGCCTGAAGCAATCGGTACAGAGTTTGCAGGTAGGTT
CCAATAAATTCGTGTCCAGGTCCATGGCGCGAAACGATGTCGTGCATTTCTCGTGCTACGACATAGACTGCTTTTTCAAAAGGTTTGTTTGGCTGAGCAA
TCACGCCAGGAGTCGGAGTGTTCACATTCAACTCCAGCGCCAACGAGTGCATTTCTTCATCCAGACCTTTTGGTAACTGACGCTGAACACGAACAGTTTT
CCCGTAGCCATGGGTTGCTAGAAGACCCAGGATGCTCGCTTGAACGACTCGAAGCTCACGGTCCATGACGGTCAACTCCTTCCCATTTGTGCTGACAAGA
TTGCCCCCTTCATTCTGGATAATTTTGCGCGGGAGCATTCGCATCCACTCTGGGTGCACTGTGGTCACAACATCCACTTGATGGTTCCCCAAAGCGTGAC
ATGATGCGAGTAATTCGCAAACGATCTTCTCGTTGTGTTCGCAACTATACGTGCGGCGAATTCCATCGATGTACACCACTTGAAACGAAAGAGGCGAGTC
GCGGAAGAGAATGAGACTGTAGATGCGAGACAATGGACGACTCGAAATCACCGTCTGGGGGTCCACTGATTCCGTGATAAACTTCTCAGACACAGAGAGC
AAACGAGGGGTAGAATGGTTCGATTCGAGCGAGATCTTTTGCACCTGGTACTGAAAGGACATACCCTCCCCCAGTGTCGCCCCAGTCTCATCTTTGCATG
CAGCTTCCAACGTCTTCTTTCGATATTCGTTCACTTGGATGCCGTACGCTTTCATCACTCGCTGGATCGCTTGCGCTAGATCAGTTCGCTTTGGGACCAT
GAAGAGACTGGAATTGTCCGAATGGTTCAAACAAATTGCCTGGTGATCATCGCAAATCAAATCAATCGACACGAGGCTCGTGTATGGGATGTGGGACATC
AATTCGCCATCACTGTCCTTCTGGTAGATGCCGTCCGGTCGCACCTCGATGGCACACGGCGACTTCACTCCTCGTTTATGATACTTCAAGCTCTGGAACG
CGTACGTCTGCAATTCAGGACGAATGGGTTGGCCTGGCGACTTTGCCTGGTGCAAACTGCGAAGCCGCATCAAGCACACGAGCACTTCCATGCGAAAGTG
GCAACGATAGATCGTCTTTTTGACGCGGTGCCGTGGCGTGTAGATGATGAAATCCTGCGGCCAAAATGCACACAATAATTCACGCAATGCAGATAGTTTG
TTAATGTCTACGAACGTCGTAAGCCGTAAAAACGCCAAGCGAAGAGTGCAAAATGCAGGTAACGTACCGATTCGCCTTCGACGACATTTGCAGCATCAAC
GTCTTCATACGGCCACGTATTGGTGATCTGTTTATTGTCGAGATCGTACGTGCAAAAGCCATACTCGCCAAAGCAGAGCACGCGCTCTTTCACGACAAAG
CTCCCCACTTTGTGAACCATGAAGCGCGCCACAATGCGACGCATGTCGAT