Description :
From Genome Similarity Track
Location :
Scaffold_4518:55- 1962
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4518-snap-gene-0.1Ankyrin repeat protein

Sequence
1907 bases(100 bases per row)
CTTCAGAGCCAGACTTGCACCACTCTCGACCAGCAGCTTGATGCACGACGAGCTCCCGTGCAGCATGGCGCAGTGCAGCACCGACCAGCCACTGCGGTCT
ACCAGGTCGATCTGCACTGCACTATTCTTCAGGAGCACCTGCAAGGTTTCGTCCATGCCACGGGCACCAGCCCAGTGGAGCGCTGTCCTGCCGTTGGCAC
TCGCGATTGCCGCATCTGCACCAGTCTCGAGCAGTTTCTCCACGACGCGCGTGTGGCCATTCGCAGCAGCGCACATGAGCGGCGTCCAGCCGTGTCCATC
ACGCGCGTCCAGCTTCAGATCCAATCGCCTTTGAACTTCGTCTCCGTCTGTCGCGTCTCCGGATGCACCGCGTTCCAGCAGCGTCTCCAGCACCTCAAGC
TGTCCAAAGTCTGCCACGTAGTGCAGAGCCGACCAGCCCGAGGCGTCTGTGGCGTTGGGGTCGCAGCCTCGGGAGACCCACTCGCGCACGCTGTCCACGT
GTCCACGTCCGCAGGCGAGACGGAGCTCCTGGCCGAACTTGTAAGCGGGTGCGTACACTTTGGCAAACAAGTTGAGGAACTCGTCCTTCGTGATGCGGCC
TGGCTCAATAGTAACCTGATGTTGTTGTAGAGCCGCATCGTCAGATGGTTCTCCCTTCGTTTCCTCACTCGGTGCTGAGCTGACACTACTCTCCACAGAC
ACTGCCCGAATGGGGAGGTTGGCGACCACGAGCGACTGGTAGAGTTCCTCTGAGAGAGCCACGCCCGTGCGTCGGAGCACACTCACGACTAGCTCAACAG
CGATGTCCCCACTCGGGGTGCTTTCACCGACTTCGCTCTCAAACGCCAGCCTCGCGACCTCAAAGTCCGCCTCGTGCAACTCGCTGATGCGCGCCACATC
CAGTCTGCTGGGTCCGTCGATGACGCCGCCGGCCACCGAGAGCGTCGTGAGGCGCGCGCTTGGTCCGGGTGACGCACTTGCACCACCACTCACCAGCGTC
TCGTTGGGCGGGTTCTGCACGCTGGCGATCGTGAGCGTCACGCTGCTCTTCATGGGGATGGCTGCCTCCGCCCCCACTGAGATCTCCAGTGCGTGCTGCA
AGCGCGTCCAGACCGCAGAGACGACGCTGTTGTGGTGGACTGCGTTGCACAGCAGCACGCGCGGGTGGTCGGCCATGTCCCAGCCGTCCGTCGGCAGCTC
GATGAGGATCTTGCCGCCCGGTGGGATCTTCCCGTTGACGCGGAAGCTCAGCGAGACATCCGAGATGGCGCCAGGACAGCAGCTGAACGGCAGCCAGCGT
CTGGGTCCACTGACCTGGCCCGGCAGGACCTTTTGTAGCACGAAGCGACAGGGGCCGTCGATGATCTGTCCACCGCGCTTGGACGCTGGCACCGTATTGC
GCGCAACCAGCTTCTCAAAGGCCGTCACGAGGACCTCACCCTGCGGCGTGGCAGACTCGGGCGTGCGCACGCCGGAGACGACGATCGCCACGGGAATGTC
GCTGGCGACGCCCTCGTGTAGCAGCGTAAACTCTAATATCCGGGTCGCTGGCGTCCACGAGGTCTGGAGACTGGGCACAGCGCAGCCCTGTGGGAGTCTA
AGCAGCGCATTCACCACTGGACAGTCAAGTGATGCTGATGAAATCAAACTCCAGCCGTGATCGGGAAGCTCGCATGTGACGCGGCTCTCCGCCGGCAACG
CGCTGTTGGTCGTGAAGCAGATCGCGAGTTGGCCGAGCACGCCCGGCGCCGCTTCCTCGGGCTCCACGCAGCGCAAGCCTTTGAACTGTCCAGCAACGAG
CTTGCGGTGGCGCTGCGCGAGTCCCAAGTGCGCGCCGCGAGCCTCTTCGTCCTGGTTCTCATCGTGGGGACTCTTTAGTCCGTGCGAGCCCATACGCTTG
GCCATGC