Description :
From Genome Similarity Track
Location :
Scaffold_75:54989- 57297
Transcript NameFunction/comments
Hyaar_Emoy2808168PREDICTED: inhibitor of growth protein 3-like

Sequence
2308 bases(100 bases per row)
CCTGTGTTTCTATGTATGTAGCTACAATGCTGACGACCTGGCTCGGTATTGTATGATTAATGACAGGTGGAAGCTCTGAAGCGCTATGGCAAGTTTTACC
ACCTCAAGCTGAATGAAGACTGGACGAAAGAAGAGCTGGCGGCTCAGGTGGCACGGCACTTCGATCTGTCGCTGGAGGTGGAGGAAGACGACTCGATCGT
CGCATTCATGCAGCGGCTTCGCAATGGCGAACGGACGGCAGTGAAGCGCTCATCTGTGCGTGACAAGGAGCGGAAGGCACTGATTGCGGCGGAAAAAGCC
AAGCACAAGTCGACGAGTCGCAAGCGCCAGCGCGATCATTCTGTGTCGATGCCATCGGGACGCAGCGCTAACAACAGGTCGAGCCACACGGCGAGCACAA
CTACTGCTGGCAACTCGTCCAATCACGGACATGGCAGTAGCCATTCAAGTGGAACGGCGAGCAGTAGCCACAGTAGTCGGGGTCAAGGGAGTGAAGGACG
CAAAGCGCCTCCGAACAGCTCGAAACTTTCGACTGCGTCAGGCGGCAAGACAAAGAAGACGAAGAAGGACGCAGACGCGGGTGAAGACAACGAACTCTAC
TGTATCTGCAACCTCCCGAGCTATGGCAATATGATTGCTTGTGACGGCAAGACGTGTCCGAATCCGTCGCAGTGGTACCATCTCGAGTGTGTCGGTCTTG
CTGACGGTCGCCATCCGGACACATGGTTATGTCCCGAGTGCGACCCCAAAGGCTTTGCTAGTGGCTCTTCTAGTTGCCACAAGAAGAAGAAAAACAAACG
CTCCAAGTCGCCTGGCAACAAGTAATGACGCTTGGATGCGTGACGAATTCATTGTGAGCAGCAAGAGTTTGCAGGATAAGTTGCTGCCACTGACACGAAT
GATGCATGGGTTTTCTGCCACATCCGTTTGTCGGTCTTTTATCGATCTTTTAGTGATTCCGTCGCCTGTGACTTCCAGCTAAGGTAAAACGAAGAAGACT
GCTCACTTTTATGCTATCGTTGTTCGTACATCGCATCCTTGGTGTGTCCGTCGAGAAAGTCCACAAAGTCAGACAAAGCTTCACTGGCTAGTCAAATTCG
GCGATTAACGACCTTTCGGGTTTCTTGCTGTATGGCGTGACTACAGACCGCAGTTGAGTTGCTTGTGGCACCAAAGCTGGATTAGAATATTGCTGATCTC
CGAAAGACCGTCGAAATGGACCAGAACTAATCGCAGTGCGTCATGAAATGCCTTTCGAGCTGTTAAGAATTTGGGTTCACGTTGCGCTAAGATAAAATGA
AGATGAAGAACAAGATCGACGCCACTGTGAGTCGTGTGTAAGGAAAAAAAGATCAGCGTAAGCTGTGGTCGCGACACATGCGGTGAAAAGCCTTCATTGA
CCGAACTTCCGATCATAATGTAATGCGATGTTACTATAACCTTTTCGCTCCATGAAGGTTATCAAGAGCATTGGTACAAAGAATTAGCAGTCGCATAGAC
CAGACACGATTAGATCTGTGAAAAGACCGGATATGTATGATAAGAGCTGCTGTAAGTCATAATATACGCAACTTCGAGCTCGACAGTAAAGCCACCACTT
CAACTTCAGCTCACGCAGCTGTTCATTCTGTGACTTCACAAAAAATGACCAGCCTGAGCCTAACGTGACGTTCGTCGCAAGTACAGCTAAGCAAGGTTAG
GTCAGTCGAACCAACGGCACCAAGCTCTGTATTAGGAATCGTTGTGATACTAAGGAAAACACTGCGATAGAAAAGTTACTGCCTAGGTGGAGGGCTGTTA
AACTCTGCGAGTGCTGGATATGCATTTGAAAGATTCACAGCTTTTTATTGGCGTCGATGCAGGTCAAACCCCTTTATCGGTTTATCTACACTGCTGACAC
TTCTAGCAGCAGCAAGAGACACTACCTTTATTCCCTTTCGAGTTAGCATTGTTGCCAGAGGTGATGCCCCATTGTGCTCGAAGAGCAAGACAAGCGCTTA
AACGTTTGCTTCTTTGATCTACTTTGAAGAACTACGACATCAGATCGTTGCTTGTAACTATTGGCGCGTTTGGCAACCTCATGAAACTGCAATCTCGGTA
TTGCCTGAACGCTTGATGCCTACGCCTCAACGAAACTTAAGCAATCACATCCGTCGGCTTAGGCACATTCCTGTGGCCTGCAGCTCTAATACGAAGTGGT
GCGTCTTGGGGCAAAATCATTACCGACGTTGCGAGCGCCCCGTGGCGTCTAGAGCTTCTGCGCTCGGCATGATCCGTAGCATTGTTGTCTGCAACTTCAG
CAGATCGC