Description :
From Genome Similarity Track
Location :
Scaffold_41:54987- 59985
Transcript NameFunction/comments
Phypl_g1579hypothetical protein
Phypl_g1580hypothetical protein PHYSODRAFT_468947

Sequence
4998 bases(100 bases per row)
AGAACCGTATCGCTGATGACACTGTGGAGACCATCCATGATGCTCGAAATTTCCGCTCGAACACTATCAAACAGATAGTACTGCGCCACTTTTGCGACGT
AGAGCTGTTTGTTTCCATCGTGCAGTGCGACATCGGTACCACTTGGGATAAGCTCAACACCTTCAACCGTGAAATTCAAGCCCAGGGCATTGGTGTTGTC
GTTTTCAAGAATCCACATCATACTGGAATACACCGTTTCATCGAGGAGATAAAGGTCGGACAGCTTCAGCGGTGCACCCAGAATGTGCTTTAGCAGGGGG
ATCGAAAGCCGCACATTTAGGAGAAGACCTTCAAGCAACGCTTTTCCTAGTAGCTTTCCAAAGAACACATACATCTGATGCAAGAACACGCGACCATTAG
ATCATGAGTTGTCAAGATGTAGCACAGTACAGTCAGACATACCTCCAACTGCTTGGTGCACTTTCCGGTGGCAGTTCGATTGATCCAGTATCCTTGGTGC
GCTGATGAGCTCGTTAGCGTAAACAGCCCCGGTGCGTCGGCAAAAAGCTGACTGCAAACTAAATGCAGCCACTCCCGCAAGATGCCACCACCGTCAACGC
CAGCCTCATCCATGAAGTCAACCcgaaggcgacgatggaggGTTCCACTTGGTGCCGACATGAATAGAGTCCTGGACTGCTTCAAAACCCTGTCGCGATG
AATGCCTGTAGAGTGAATGCCAACAGCAATATTagccacgtccagcagcgaaCACACAAGTAGGTAACGTACGTATAGTATGATAGCCATCCACAATCGA
TGAGCACAACTTAAGCGAGTACTGGTAAAACCACTGTGCTTTTTCAGAGAATGTTAAGGTCGACGCCCGCTGTATGTTCGACAAGAAAAACAGTCAGAAC
GCAGTGCGAGCAGTCGAAAGCAAGGATCTGAATCCTGTGTTAGTTACATGATCAGCTTACCACGACGGCTTTAGAATATTGGCGAGATGATGTGGAAAAC
TCTtcggccaagcgccagcgcgccgTTCGACTTCCAGCGTGTGAGTCATCTCGTACGAACGCGGTCCCGGGAGTAAGCCATGAGAGTTGCTGCCCACTAC
TGTCCGAAAAAATGACAGAAGACACAGACATCCGAGACGATCCTGGCAATTGAGGATGCCGCTTTTGCCACTCCTGCAAGTCGCGTTCTTTTATAATAAC
GCTGCACAAGGCGTCATTATCCTCGAGGGCTTCAAAAGGGATATTCACCTGGGTCCAAAATATTGTTCAAGTTAGTCCAAGACACACAAACATCCACGAG
GCGCTTAGCCGCCTTACCCAGCGCACGTTCTGCCCCCCAATACAGCGCTTCCATTGATGACGCTCGCGTGCAACCAACTGGCGGTCACTCAAATCTCCAT
TGTGAAATGTGTTTAGGCCCCGAATCCAGGCcgcgcgaggagaagacATGAGCAGGTAGTTGGAAGCGGACCGCGTGCTTGCTTCCACTTGTGAGGCAAT
TATTGCCGACGCGTTTGCGTCTTCGCGTCGGCTTCGAATTATCTTGAGGTCTGCAATACACGAAGCAAGTGCCGCGGAATTGACACGGAAGAACGTGAGT
AAAAAAACTTTATCCGCATTTGTCatgttgctgttgtccgGTCCAACCTTCAGCTGTAGTGCCGCACAGCACACATCCAGTCTGGGAAAAATCATTTGTG
TGAAGGCAGACCTCGCATTTCCAGCCAgcattgctgcagcatgtccagCACAGGAAACATGTACGTCCAACTGTCATGTGAAAAACGTAACGACACCTGA
TACATCATCTCAAAAAGACGTACGATCGCTCGATGAAGGCTCGGTGGCGTGAGCGTCGactggagctcgtgcagcactcGACACAGGCTTTCCATGTCAA
GCAGGCAGTGATCAGCACTAGTCCGATGCCAATGCTGACACCGATGATCACGgtcgtgaagctgctacCGCCATTCGAGCTGTCCTTATCGTCGTTGGTA
CCTACATGGCTCCCATCTACTCAGCAAATAAAACAGTTCACACGTCAGTGTCGCCGTCCCCACTTTCAAAGGCTACACACCATTGCCCCGTACAATTGTA
ATCGTAGTCACCCGTGATGTTGGAGTAGGTGCCGTCTAGAATGGGCATGAGGCCCCGCAAGCCCACGGCTTCTCGCTCGTCAGAGTCCTCTACTGCTCTC
CGTAGCTGCAGCCGCTCTTCTGTGTCTGAATCTGTCTCCGTCGCGGCTACTGACTTGATTGTGCACAACAGCAAAGCTACGACTATCGACAGGAAGGTCC
GACGTCGCGTCGCGCTCGCCCTcgcggcgccggcgacggcgactcgCATTTCGGCCGCCTGAGGGCCGCGTACCGCGCGCAGTTGTATCTCGGTGTTCAC
TGGCGCATGGACCCTGTGGTGTCCACCCATGAACAGCCTCGTTCCGAGCCGAATGCTGCTCAAATACCGAAATGACTCGTATTTCGGCCAATTGCAGAAA
TCGTCAGCAGAGGTCTCGGCGTGCATATCGAAAATCGGATTTGCGGACGGATTTTTTCTTGACGTGGGACAGTAACTTACTTACGGTTTGTTAGTCAGCA
TTTCCCTGTTGAAGTTATCCGGCGCCATGAGCACCGCGTTACATCATCACCAGCATTATATTATTTACAGTTTTTCTTTCTCTGCGCTCGCACTGACCTC
GGCATGGTGTCGATCGTTGCGTTAGTAGGCCCCGGtcggctccagcgtctcaCACGGTGGCCgtgttgcttgcttgctgccTGTGCGCAGCGCGACTCCT
TCAGAGCCGCTGCGGCACCTGGTCGAATCGCGTTTATACTTTGATAAAAACGACCGACGTCTTCGGTTGTCGGGCATTGCCCCCTTCCACTGCGGTGGCC
CAGCAACGACCGACGGCGTCCGTCTCGAATACTCACTCACATACACAATCAAAGCTCCTCCCTCTCTTGGTTCTCCACCGGCGATGGATTCATCCTCCAC
GCGCGGCAGCGCCCGTCCTCCTCTCCCGTGTTGCAATCCCCTCCTTCGGTCGGAGAGTCCACGCTACGGGGGTGAACAATTTAGTACGCTTGGCAGAACT
TGCGCAAGCACCCCATGGTGGAGAGCACCGGGTCAGAGCGCACAGCGTCGATGAACGTCTGCAGACGCACTCGGCGCGCATTCAGCACGTGGTCCGTGAG
CTCGGGCTGCACAAAGAGCACCGCGCCGCTCGACAGGTGCGGCACCTTGACGCCACGCGactgcttcttggccttgagctccttcttcaggccacgctcg
agctgctggaactcgccAAAAGTGGCCGTGACATCCCACATGATAACGGGGTTCATATGCTTCTCCGTGGCCGACTGGGCGCCGCAGTCGACGCGCACAA
CGTAAATATCGCGCGCTTTGCGCTGGCCAGGCACGGCCTGCAGGAAAGCCTTGCCGACACGAATGTTCGCTTCGCCCAGGTTCGTGTCCACACGGCGGCG
CATGTCGCCAGGCACCACATTGACCAAAAGGCGGTTCCGGTTGAGGTGCGCCAGCAcacgacgtcgagcagccGGGGCCTGGAGCTCCTTTCTCTTGGAA
GCTGTCGCTCCGTCTGCCTTGTCAGCATGGGTGGACTTGGATCCGTCAACGCAAAGCAGCGGgagcgtcggcgtcgccgcagTGGCGGCGGGTGTCTTCG
TTTCCAACTCCCGGCCGTAGTTTTGAACGAAAGCTGCGTTAGCCTTGCTAGCAGCGTTCATGGACAGCATGGACAGCCCCACGAACGTGTAGAAGCTGAT
GAGCGTGAACGCCGCGGTGTGTGCCAGCAGACCAAGGACGAACGACAGGATGTTCCAAGCCAGCACGCAGGCGACGTAcgcggcgagcagcagcgacgcg
gccgaGCTGAGGGTGACgtcgagatgcagcagcgagtcaTAGGCGCTGGTCAGCACGGCGAGACGGACGCCCGGCAGGTTGAGCACGATGGTGGGCTTGG
CGTTGTCGGAGCTCACGgccggcgcgcgcggcttcATGGCGTCTGCGGTGGGCTGCATGGCGGTCTCGGGAGTCTTCGCTATGGCGCAGAGTTGACGCCT
GATGGAGGCGAGCGGTGGTCGCAGACACCGAGCGTGACGCTATCTGGCGCTGCCCCTGTTTTTGTTGGCGCAGGCGATGGGGACTTTGGTCCCACTGTAG
AACTGGCTTTCGTGAGTTCGGACTCCGAATCGGAGCCCTGTCACTCGGCGGGGTCCACATGCCTGTGCCGGCTGGAGTAATTTGCACACGCCTGGTGGAT
TCTCCATCCCTGGCACATGTTGCCGCGGAGtctggcgttgctgctccgcTGCGTTGACGGCGTACACAACAAAACCACCACACGACCGTCTCAAAGAGCT
CAGCACGTTGAGGCCAATACGAAGTAGGATACCATCACATTAACATTTGCATTTTGTTGCCGAGCTCATCGCCCAGTCCCTACTTGAGACGCTGAGCCAT
GGCctccaggagctcgtccgTGAAATCCATGTCGGCGGTGCGGACCGTCAGATccacgaagccgccgctgcggATCTTCACGTGGATCAATCCTACGTGC
TCCGAGTTCACCAGACGACAGGCTGCAATCGCTTCGTTGGCTGGAGTAAACAAACAGAAGACACAGCGTTAGTACCTGGTACTCCGCAATACAGACGCAC
CAGCACGCAAAAGACACGTACTGGTCGGGATGGCTTCGACGGTGTGCACGTTGAACTGGTGCATGCGCCCCATGAAGTCCTCGAGCGTGCGGATGCCGCT
CGGGTTcaccttggtcttcttctcgcaTGGGCACGTACCCCAGCGGCCACCAAAGTCCTGCGTCGTGATCTGCCACGGCTCCAGCTGACGCCCATTGTAC
TGGAACACGCCTGTGCTGCCGCCCAGCATGTCCAGACCGTTGGCAGGGCTCTTGCCAAGCTCAACGGCAGCTATACACGCATACAAAAACGCATCAGG