Description :
From Genome Similarity Track
Location :
Scaffold_247:5498- 10944
Transcript NameFunction/comments
Albla_Nc14107250histone acetyltransferase putative

Sequence
5446 bases(100 bases per row)
AATTCTCAAGCGCAAGGTAAGGCTCCGATGAAAGTCAAGCATCAACCGTGGCATTCTCCAGCTGATCATATTTTACGAAAAGAAATGGTACATCATATAA
TACGATTATTACAAGCCCAAAAGAAAAATTCATCAGTGGGTTGGATGCAAAAGCTTCCTGCTATGGCAAAACGTTTGGAAGAAGAATGTTATGGCACGGC
TGTTGATCGAGAAGAGTATGCAAATACAAACACATTACATTCACGTCTTCGAGCCATTGTTCGTGCGGCTCAAAAAGGGCCAAGACAAACGCAGGCTGAT
GCAGCAAAAGCATCAGTACCAGTGACAGCACCGAGTCGAGAAACTCAGGTTCAATCAAGATCGACTCAAGACCTCTCACCGATTCCATTTCCGGGAGAGG
CTCAATCGACACCGAGTCCTGTTCCTACAGCGAGTATGCCACAGATGAATTACCAAGAGATGGTGATGAATCATCGCTACCAAAATCAACTTCTTCAAAT
GCCTGCAGAAATGCAGGATCAACGCGATAGCCTGAATGGATTGCCTCAGCAACAACATACCCCCCAAGCAGCACAAACAGCTGTGAAATCCTTACCAGAG
AACCACTACACGCAGACACAACAGGATTCATTTAAACAAATGAACTCGGGTAACTTGACAATCCCAGCCAGTCACGGAAAATCTGCTCTCATTATCCGAC
AATTTAGGGCCAAAGCACATCAAGTCACTTCTTTGTTAGCTGAAACTCGAACTCGTGAATACCATCGCAAATTACAGTCTATTACAACCGCGGAAATCTC
TCAAAACGCCGAGTCAAAGAATGTGTTACGACGGCAGCAAGAGAGACTGCTGATATTACGTCACGCAATGTGGTGCAAGTCGACCAAGCCAGAATGTGAG
GTCTTAGCAGTATGCAGAGAAATGAAGCGTCTATGGGAACATATGAGTGGATGTCAAGACACGCATTATTGTAAAGTTAGTCACTGCCTGTCGTCACGCT
ATGTTCTCTCTCATTTTCAGCAATGCGTGAATGCTAAATGTCTGGTATGTCAAGTGGTTCAGTTTCCGGTGGAAGTGAAGGAAGAGGATGGAAGGTTGAT
GCTTGATGCTGATCGAATAATGCAGCAGATTGGTTCCATTACACGAAATCGTCAAGCTCATGTAATGGCTTCGATGCAGTCGTCAAATAGCCCCTTCGTC
CCCGTGCCAGGACGCCCACACTCTCATGAAGGCTTGAGTAATAGCAAAAGTGTACCTTCAGATTCCAGGCAGCCTTCCAGTTGGGCACCAACAGCGAGTG
ACTCCGTGACACACACAGCTGCTCAAGGTAGACCGTCTCCTGCCACTCCGACGGACATAGATTCGAATTGTATGCAACCACCACACAACACTTCAATGCC
AATGGATGATCAGTCCTTCTTTCATAATGTATCAGAGGAAGAGCGGCGTCAACTTACCGCCATACACGAAAAGATCCAAATATGGTCTTTAGATCAGCTA
TTGGCGCATTGTCAGCGTGTAGAAGGTTGGGGAGGGCAAATACGCGCACAGATGAATATGATTGTCAATGAGTGCCGGCATATGATACACATTGCTAGCA
ATTCTATGGATGCAAACATGAAGGCTCAATACAATGCGCAAATTGCGACCAAGAAGGGAACGCTCAAGACCTTGGATACAAAGTACAAACGCTGCAGTCT
ACAGCATCGTCTCGTGAAAAATGTGATTTTCTCCAAACAAAACGGTTTCTCTGCAAATTCTAATGGGATGATATCATCCGTACCAGTTGATTGCAATACT
GGTCAGCTGGTCCAACCGGAGCCAACTCAAGAATTTCCGGCTCCTTGGTTGCAAGGAAATGGTCCTGTGCCCATTCCATTTGATAATATGACGCACACAG
AACAACCTCAGGTATACCAGCAAGAGATGATGGACTCGTCTGTATTTCCGGTGGTTTCGCCTGACATTACTGATTCTCACAATGATAAACCGCTGGAGAT
GCCACTCGAGTTGCAGGACACAAGGAAAGGAGAAACTTCGAAATTCTCTTCGTCCAAACTGATGGGAAAGCACTTCAATTCAAAGGAAGTATCTGGAACC
AATGATGTGCTCTCCCAATGTAAACAGTCGATAAAGGTCAAACAAGAGCCCACGAATCAAAATTTCGTTTCATGTAAGGAGAAGGATGACGACGTGAAGG
TGGAAATAAAAAGCGAATGTGACAGCGGGAATGAAAAGTGCTCCAATTCGATATCTACTTCAAAAAAAAAGGATCCATCACCACGCTCTTTGCCCTCTTC
CAATACCGCTACACCGATTTCAAATACAACAGATGTCTCGACTTCTATGCTCAACGAGCTCAGCAACGAGAATCTTCGAAAGCACATTGAGTCTCTTGTG
AAGTACTACAATTCAACTTTACCGATGCCTCAGCTGAAGAAAAGGCTGGAAGTATTGCTGAAAGGAATGATGGAGCACAAGTTTGGCTGGGTTTTCAGTA
GTCCTGTTGACACCGTAGCACTAGAGATTCCGGATTATTTCCGGACAATTCGACGGCCGATGGATTTGGGAACGATAAAGAAGAAGCTGGATTTAGGATT
CTACAAACACATTCAGCACTTTGCAAGTGATGTACGACTGACATTCAATAATGCGAAATTATACAACAGCGAAGGCTCTGATGTACACAACTTGGCCAAA
GACATGTTGAACGACTTTAATGTCGAATTTCGGAAATTGGAAATCGATATCAACGAGCAAGAACGACTCCAGAGACTGAAAGAAGCTGCTTGTCGATTAT
GCGGTGTAGAGAGAATGCTGTTCGAGCCGTCTGTTTTATACTGCAATGGTGAATGCAATGCTCGTATTCGCCGCAATTGCTACTATTACGCGTCTGTGGA
CAACAAGTATCACTGCTGCCACCCTTGCTATGGCAATTTGGGTGATGCAGTCAAGTCGACCGAAGGACAAACATACAACAAATCGAGTCTTTGTCGTAAG
AAGAACGATGAAGTACATGAAGAGCCCTGGGTTCAATGCGATAAGTGTAATCGGTGGGTTCATCAAGTCTGCGCCTTATTCAATGGTAAAATTGACGCAG
AAAAGAAGCCAGCGACCGTCAAAACAGAAGATTCAAAAGCTGGAGCTACAGAAGACAATAGTCCTAGCAATGGTGTATCCGCAAAAGAGATGAACGTGAA
AGTGAAGCCAGAGGGAGCTCGAAAACCCGCAAGAGACAAAAAGAGTGGGGGTCCGTCAAGTGCATCGATATCCAATGTACCTGGAGGCGAGTTCCTCTGT
CCAGAGTGTCTACTCGAACACCGATTGAAAGAGCCCGGAAAGTATCGCGTCACTCGACACGCATTTAGTGCTAAAGACTTGATGCGAACCAAGCTCTCCG
ACTATTTGGAACGATGGATCGCTAAAGTGCTTCAGGAAGAGCGAGAAGATGAGGCAGTCTGGACAAACCAAGATGCCAGTCGTGTTTTTACCGCAGAAAA
TCTCACGATTCGACAAGTTTCCAATATTGATAAACAATTGATGGTTCGAGATAAAATGTTTTTTCGATACAAAGAATCCCACAATTATTCGTCAGACTTT
CGTTTCAAGTCGAAATGTATATGCATGTTCCAAGAGATCCATGGGGTTTCCGTGTTGTTATTCGGCATGTATGTTCATGAATTCGATGAGCAAGAAGCCC
CAGCAAATGCCCGACGTGTTTACATCTCGTACTTGGATTCGGTCAGCTACTTTGAGCCATCTCATTTGCGAACAAAAGTTTACCATGAACTCCTGATAGC
ATACTTGGATTTTGTCAAAAAACGTGGGTTCTACGCTGCTCATTTATGGGCATGCCCACCGTTGAAAGGAGACGACTACATCTTATACTGCCACCCAGAG
ACGCAGAAAACCCCAAAATCGGAGCGATTACGGCAATGGTATGTGGATATGCTTGTCAAAGCTCAGGAAAAAGGAATTGTGTGGCATATCACGAATATGT
ATGACGATTACTGGCGGAACAATAATCCTGCGTGCAAGTTACCCTACTTTGAAGGAGATTATTGGGTCGGTCTTGCGGAAGATCTGATCGAGAAAATCGA
GTCTGAACAATCCAAAAAAGCGACTTCGAAAAAGACGGCGAGTTCCAAGCGGAAGACTTCAAAGAAGCTGACTATGAAAACAAAAGCAAAAAAGCAGAAA
CGACGAAAATCAGGCAGCTCTCTCACGAGTGCGAGTCCAAAACAATCCCAATGGAACGGACATGGTGGGGATAGTGAGGATGAAGATGTAGACCTAGATT
CGCAGCCAAATACAAAAGAGACTTTGGTAGCACAAAGCTCGGAGAGTATTGAATCAAGTCCGCATATAGGCTACAAGGAACCCGAAACAAATGGAAAGCG
AAAGAAACGTATCAGCTTGGAAGTATTTGATCGCACAGTGACAGATCCGTTGATGGTACGACTGGGTGAGGTCATTTATCCTATGAAAGATGATTTCTTG
GTTGTAAAATTGCAGCCATTCTGTTTCGTGTGCAATGTTACTGCGGTCAAGGGGACACTATGGGTGGATTCGGGCGTGAAAACAGAACACGGCTTGTATG
CCAAAATAGTACAATTCACACTTTGCGATACATGCTACCAAAATGCGAAGAAAGACTCAACACCGAAGGAACGCGTCATTTTAGAGACATTAGTACCCCA
GTCCATTGCATTGCCATCGAAGTGTACTGATTTGGATGAGATTAATGATAATGAATTCTTCGATACAAGGCAGGCTTTTCTCAGTTTATGTCAAGGGAAT
CATTATCAGTTTGACGAGCTACGTCGGGCTAAACATTCTTCTATGATGGCATTGTACCATCTTGGAAATCCGAATCCAAATGCGTATGTTTATGAATGCA
ACAAATGCGCTCAAGATATCATCAGTGGAAATCGTTGGCATTGCAAAACTTGTCCCGACTTTGATGTATGTGACTATTGTCACACCAAGGAGAAGCATCG
ACATCCGCTACAGCTCATTGTGGTGGCACCCAACTTACCTTCATCCAAAGCGGTTGCTGGCCAATCTCTGACAACAGGTGATTTCAAAACAAGTCAACAA
CAGCGTCGAAGTCGAGAAGCTCACGCGAAAACTGTACGACTTCACCTCCAATTACTGGTGCATTCCAGCAGTTGTATTGGAGGATGTGCCTCTACAAATT
GTGAGAAAATGAAGGAATTAATGCGTCATGGAGCACAATGCAAACAACGCGCATACGGTGGCTGCACGATATGTCGACGCGTCTGGGCTTTGCTGCAATT
ACATTCGCGACAATGTCGCCAAAATGACTGTAAAGTTCCACGATGTGCCGATCTTCGTGAGCATTTCCGTAAGCTGCAATTGCAGCAGCAGTTGATGGAT
GATCGACGTCGTGCAGCTGTGACCCATCAATATCGTCAGATGCAAA