Description :
From Genome Similarity Track
Location :
Scaffold_997:5496- 6747
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_997-snap-gene-0.4Gene of unknown function

Sequence
1251 bases(100 bases per row)
GTGGCTTTCACAATACTCTTTCGAGAAGCACTGGACGCAAACCCATTGAGACCAGCGTCTTTCACCTCGTGAAATGCTGCTGGGATGACCAGACTGCTCT
TGCGATGCTCCGAAAGCCGTCTGTTTCCGCTCGACGACACCTTGGCGCTAGAGTTTGCAGCATATTTCGATTTCTTAGACGACGATTTCGACGAATCTTG
TGGCGGAGACTGCACAGTGGTGATGTTGGTGGAAGACGACTTTGTGGAGCTCCTTCGCGCACCCATTCCAGCTGCAGTAGATTTATTCCTCATTGGTTCA
GTCATGATGTGTGCATTCGAGATTTGCGTCTCGCTTGGCGAAAACACATTCTCAGCAGAGGATAACGGCGCATCATCTGAGAGAGCAACTTCATTTGCCA
GCGCCTCTTGGTTCATTTGCTGGTCAGCTTGAACTTTGTATTCATCATTCTGCTGCTCGTTGCTTTGATGATCCTCCTGTTCATCGTGGTGCTCGTTGTG
AACATCATGAAGATCATACTGAGTTTCATCGGCAACCTCCAATCCTGTACGTTTCATCGCAGCGACTGACACATTTTCGGAGCCTCGATTTGTTTCGCTT
TCCGATTCATCATTATGTGTCGCTACATCTGCGCTCTCGTCCTCAGCAGGTCGCGCGTTCACCCAATCAGGCCGCTCTTGAGAGAGTATAAAGGTAGCGG
ACGCTACAGTGTCTTCCACGTTGTTGATGGCATCTTCAGTGTGCGATGGACGGGAAGTGGCCGTGCTGACAGCATCGACTCTGCCCAGACTTTTCGTGCG
CAGGTCCTGTTGACTATCAAACAGAATTTCTTCGCCAGCTCGTTGAAAAGGCTCGCACGAGACTGAATACTTCGCAGGAAACTGGTCGAGACTTCGCGTG
CGAAGCTCCAAGGCGCCACTCTTGTGATGAAGATGAGAGACTTCCACGAGACCACGAGGCGTTTGCTGTTGTGTCAGCGTCGACTGAACACGGGGCAGAG
TTCGTGGAGACAAAGGCGTGGAAAGAAGCCCTTCCTCATTGAGTGACTCATTTCCCCAGCAGGCCTGCCGAGGGGATACAACTGCAGCAGACATTGCAGA
CTGGATTCCACACATTGTTGGTGCTTGCTGCGCGCCATTCAGCTCACTACTAACAGCGTTATCATCATACCCTTCTTCTCCAACTGGGTCATTGTACTGC
TCCGATTCACTTTCCTGGATCTCTATGATGTGTGATGCAGTAGCAGTGCTT