Description :
From Genome Similarity Track
Location :
contig_22:549598- 552486
Transcript NameFunction/comments
g4816.t1hypothetical protein PHYSODRAFT_516317

Sequence
2888 bases(100 bases per row)
AGATTCGTTCTAAGCGGCACTGGAATCGAGTCCGGCATCATTGACTCTATCGGAGGTTGCAGTTCCGCAAGCCACTTCTGCCTCTTTGCCAACGACTCCT
CGGTCAACTGTTAGCACGTCATCTGTGGCGTCCACCATTGTTTTATCGTCGGCTCCGTCGTCTCCATCCAGTGTAATTTCCACTCATGCAGCGGAGGCCC
CAGCTTCTCGGACATCTCGTCGCCGCTCGACTCGTGCTGCCGCCGCCTTATCTCGTCAGAGCTCGGCAAGTGTAATTGCGCAGGAGGCGGTGGATAACGA
CTTCATTCTTGGATTTGGCACTCCGGTCTCAAGCCACCGGGTAGTCCGGAGTCGGCTGCTTCTCGACCGCGTCACAGTGAGATCTCGGGGAGGAGAAGAG
GGTGGACAATCGACAGAAGTGGAGCTTGGAGCAGTGGAGCTGGGGCGGACTCTCACAAACACCCGCCCGTTCGGCCATCTGCTGGAGGTTCCCGTGCGCC
ATACACTCCTGTTCCAATGTCTGCTCTAGACCCGGTTGCAGTCAGGCGTGATCACCGTCCTGTACGGCCGCACACCGTTGTCTTGGCAACTTTGTCAACG
ACACCTGGCACCAACCCGAATGCAGCGACTCCGGTAGCGAGCCTTCCTCCAGCAATTCGAGGGTGGCAACCTCTCGTGAGGCCTTCACGAAAACTCGTTG
GCTGGGCCTATGACTTCTTGGAGCCTGGTTTCCGCTTGAAAGGATCTCAAATGTGCTGGAACCAGATCATTAATTACCGGACACAACGCCGATTGGAGAT
CTCGTTACGCTTTGTTCCGCAGAGGGTATTAAAGCCTTTGCAGACTGGAAGCGGCCTGATCATCCGTGGCGACAAGTCCAGCGAAAGATGCCAGACCACG
CGTGCTTATTTGACGTGGAACCGTTCATGCCTGATGTCCACATCTCGATTCGAGGACCAAAGACGCACCGCACGGTCAAGCTTTGGCCACTACGTTCGTC
CGTGCAACCCCTCGGTCGAGCTATTCGTGCCTCGGGGAATGACGGATGTTGAGGTTGGTCGTGCTGTGGTGGTGAACCCGAGCTCTCGGATGCTGACATT
CACCCTGGTTGGCATGAGATGGTCGAGACGTGGTCTAAGGAAGGTGAGTCTGGCAGCGAGGATTCGGTTCCGGTTCCAGAAGACCCTGCGTCTAAGACTT
CTGCTGATCCTAGCCTTCACGGGCTTGTAGTCGGGACCGTGACGACCATCTAAGTCTCGGTCGTCATCTCGCAAGTGTCGTCACGTGTTCTCCAAGCGCA
TCCAGTGTTAGCCGTAGCGTCTTAGTGTAGTTGGTGCACCTTGGAGCTTCTTCTTCTTTCTTAATGCTTCATTCCGGATCTCCATTGTTCGTTCACAAAT
TCATCAAATGCAATATGTAGTCTGCTGCAGTAGCTGTTTTCGTCTGTAGTCTTGGGCTGCATTGCCCCAAGTACAGGTCATCATGATGACAACAAATGTT
GTCTAGTCCTCGTCAGCGACTTGGACCATCTGCAAGCGCTGTTCACGCTTTTTTCGCTGCAAGTAATCATACAACATGCCCCCGCACGAGAGGTTCGATA
TGGGTTCCCATGTTGGCTCGTCCTGATCAGCCCATTTGATCTTAAACTCTCTGATCGATCGCGCAGTCCTCGTTGACATGGGCATTCGATCGTCGAGGAT
CTCCAGGACCTCGCTTTCACCAGCCAGCCGGTCAGGCTCCCAGCTATCTTCGGGCAGGAGTTCTTCATCAAAGTCGAAACGTGAATCCTCAGTCACATCC
TGCGTCAACCGAGTCCTCGGTCGGTCCTCGAACTCGCTTACTGCCTTCAGGCGTGACACATGAACCACTGGATAGAAACGATATCCACTCCGATCGGGCA
GTTCCAGCTCGTAGGCGTATTCTTCCACCTTGTTCTTTACCCTGAACGGGCCGTGCCATCGGTGGGCAAGCTTCTTAGTCAATCCGGGCTTGACGCGCTC
CATATACAGCCAGACACGGCTTCCTGGTTCGAAGAGAGACTTCGTCACTGCTTCAGTATGTTCGTCGTCTGTTCGTTCGCCATTTGGATGGTTCCGGCGT
CTCATCGTTCGATCGTCGAGGTACAGCTGCCTGTTCTTTTCGACTTAAGGCTTCGTTATGTTCCTTGGCTCGACGCGTCTTTTCTGCTGCTTGGTACTCC
TTGGCCATTTCAAGCGCTATTCCTTGCTGGCGATTCACCTCTCTTCGCCATGCTAATGCATCAGATTGCTTACCGGAACCTCGTCGTAGTGAAGACGTCA
TTGCATGCAGCGACGAGTGAGCGTCCCACCCATGTACTAGGAAGAACGGGGTCTCCTTTCGCGTCGTATCTTGCGAATTGTTGATTGCGAACACTAATCG
CTCTGCAATCTCGTCCCAGTCCTGCTGCAGCGGATCTTCGACGTACACTTTCACTGACTGCATGACGGTCTTTACTGATCGCTCTTGTTGGCCATTAGCT
TGCGGTCGATAGCTTAAAGTCGCTCTCGATCTCGATTGCATCATATCAGCAAAGGCTTGAAAGACCTACTCATAAAACGAGGATCCCTGTCGTGCCGAAT
GAGTGCAGGTGCACCGAAACGTCGGTATATGCATTCTTCGAAAGCTTGGGCCACCATGAGAGCGGACGTGTCCGACATAGCTTTGGCAACCACGAATCCA
GTGAACGAGCACTGGAACAGTAGTAGCGCAGTGTTACCGCGTCGAGACTTCGGCAAGGGTATGACGAAGTCCATTGACACGATCTGGAATGGTCGTTCGG
CTAGGATATTGCCTGGAGAGTATCCTCGAAGCTGTGGACGGCTCTTACTGGAACTGCAATCCAGGCACGACTTCACGTGCTTCTCCAC