Description :
From Genome Similarity Track
Location :
Scaffold_30:54949- 63103
Transcript NameFunction/comments
Physo_134104hypothetical protein
Physo_134105hypothetical protein
Physo_134106hypothetical protein

Sequence
8154 bases(100 bases per row)
TAAGCGGCAAAATGTCCTCCTTGGCCACGTTCATCACCCGCATAATCACCTTCATGAGGTAGTCGTTTTCCGGGTAGTTGGGCTGCTCAAGGATGTTAAA
TACGTGCTCCAGCAGCTTGCCTAGGTACGGGGCAAGACGCTCCTTCGAGAATCTCAGCGAGCCGGACGGGTCCTTCACGGTAAGAAGGCGCTCGAGGCAA
GCAGCAGCGTAGGTGTGCACCACAAACTGCGACGGGTCCATGCAGTTCATCAACAGAGGGAAGAGCTGGTCCATGACTTCCACCGGCATCTGACTACGGA
ATGTCGAGACAAACTTGATGGCATCGGCCTTCAAGATGAGCGATGCCTGATTGGGAGTCGACAGTTCTGGAAGCACCTCCGCCATGAAAAAGTCCATCAG
CGGCACCCGGCTGTTCACCTCAGATACACCACGCAGGCGCGACTGCTTCATCGCGGAAATAGCAATCACCAGGTTGATCGACACGTCTTTCATCGCCCAA
TTCCGAGCCGGGTCGGCCTTGTACTGCTGGAGGTGGGTTTGGATCGTACTCATACAGATTTGCGTCACAGCCTCGTCAAAGTTGCCAAGCAGGCCACGCA
CCAAGTCGCGCGCGGCGCTGCGGCGGCTGTCACCGTCAGAGCCCTCAATATCGCGGCGGATGTAGTCCATTGGGTTGTCCTCGAATAGCTCCTCATCCGA
CGACCGCAGCTGCAGGTTCTTGACCACGATTCCGCACAGCTCCGAGAGCACCTGCGGCGACTCAAACAGCGCGCGGTGGAACGAACGCGAGGCCACCGAC
GTCAGGAACTTCATGCATTTGGCGGCCGGCTCGTCGTGCTTGGGGAAGAGCGTGATGCGGTTAGCCAGAAGGTTCCAAATCACCTCGGTAAACTTCTGCA
AGAAGGGCTTGAACTCCTCGTCGTACTTCTCGGCATACAGGTTAATGTTCTCAACGATCGCCACCAGGAGCCTGTCGATCGGACCGGGCTCGTCCTCATT
GTCCGTGTCCACCAGCGCCGGGTTCTCGTAGCTGAAGTAGCTCAAGAACTCGCCCATCCACTCGGAGATGTGGTCCTCGAAGTACTCAGGCAGGTCCTGC
CAGTTGAGCGAGTAGAAGATGCGGCTCATGTACCGCAGCGCCGCCATCATGAGCGCCTGCTGCTCGGTCGCAACTCCCGGCGCACGCAGCGCGACGCCCG
TCTCCTTGAAGAAGACGAGCAGCGGCTCCTGGAAGGCCTCGAGACAGTGCTTGAGCTCGCGGAACAGGTCGTCGGACTTGAAGACGTTGCGGAAGCGCTT
GAAGATGGTGTTGGCCGTCATGAGCACGCCGTTCTTGACCTGCCAGTCCTGCTCGGCCTGCAGCTTCTGCACCAGCTGGGCCAGCAGGTCGGGCCACTGG
GCCGGGAAGTCGTACTCGCCGATGGTGGTGAGCGCCTCGATGAGCTGCTTCTGCAGCGTCTCGGGCATGCGGCACATGAGCTCCACCAGGTGCTGCTTGA
CCAGGTTCTTCTCGTTCTGCGGCACGCAGCCCTGCTTCTCCGGGTCCCAGTTGTGCTTGATGAAGTTCTTGAAGAGCAGCGCGGCCGCCAGGCGCACCTC
CTGCTTCTCGGCCGCGCTCTCCAGCACCTGCAGCAGCAGCAGCACGTAGTTGGGCTGCGCCGACAGCGTGTTCAGGTACGCCTCGGCGCCCTTGCGGGTC
TCCGCGAAGGGCGACAGCGTCCCCTCCAGCGACTGGCGCAGCATGGGCATGTTGGGCTCCGCCATATCTGCCGAGATCTTGCACTCCAGCTACTCCTCTC
TCGGCTTCACTATGAAAAATAATAGCCAGCCACCGTTCTGGAAGGGAGCTAACACATGAAGTGACGCGTAAGTTGTGTTAGTGTGTACCACGCTATTGAT
ACTTCAGATATCGCTACTTCAAAGTGGGTCCGCATTCTCCACACTTGAAGCAGAATTTAGATTGGCATCGACCCGGGTCATGACGATGGGGGCGGAGGAC
GACGCGCTGGCGGCGGACCTGCTGCAGGTCAAGAAGCTGTTCGCCAACAACCACCTGAGCGACGTGCTGTTCATCTTCTCGTCGGACTCTGGGGAGACCG
GTGGCGCTAGTGGCGGCGGCAGCGCTGCTGCGACAGCTGACGACGAGTACAAGAGCTCGACGGGGGGCCATCTCATCCCTGCGCACCGCCTCGTGCTGTC
GCTGCGCAGTGGTGCGTTCCAGGCGGCTCTATTGCGCGCCAAGAGCAGCCAGGTGCCGGGCCAGGTGCGCTTCCCGCTCAAGATCCACGTGCAGGACACG
CCCTACCGCGTGTTCCACTCGATGCTGCGGTTCCTGTACACAAACGAGCTGGGCACAGAGGCGGAGGAAGGCGGGGGCGGTTTTGGCAGGAGACAGAGAG
ATAGAGAACAGTTCTGGCAGCAGCTGCTGAGAGCGGCGTTCGTGTACTTGGTGCCGTCGTTGGTGGACATTTGCGTGAAGAGGATCGTGGAATTTTTGGT
CTTAGAGGAAGAGGGTGAGGAGGACGCTGACAGTGAAACGGCGAAGGTGAAGGCCGAGGACCGGAAGCTGCGGCTCCAGAAGAAGACGCTGGATGTGCTG
GTGTTTATGGATACGGTGCTGGCGACAAACCCTCTGACTGCTCGAAGAAGAGAAGCGTCGGATTCAACTCCGCCGTCGACGCAAAATGGACGGCGATCTT
CCAGTGAGCCAGGGGAGGCAGGTGGCTCCGTGTTGTCACGATGCACTGAGGCGGTACATGAACTGCAGAACATGTGCCTGAAACAGCTTCGGCATATGGA
TGAAGCAGCGTTTGAGGAGCTCTTACAGAGCGACACAGGGAGGCAGTGTTCGACGGAGAGGCTGTGTGAGGTATTGCGAATGCGATCGGATACGCCGTTG
GTTGTGGCGATTCGATATCAACTCGGCCGTGTGGTGAACGAGTTGCTGAGACTTGGAGAACCGCTGGAGCATGTTGGAAAAGACGAATCGGATTTACCAT
TGGTTGCTGCGCTGAAGACGGGGAACAATGCAATCATTCGTCGCCTGCTAGTTGACGAAAGTGCGCCATTCTTCCTGTTGACTGATAAGGTTCCGTTGAT
ATTCTTAGCGAGTGCAAGTGGGAACGTACAGCACTGTGAGATCCTTATCGTGCAGAATGCAGCCGATGTTAACCTTATATCCCAGCTGAAGGACGGAGAC
AAAGAGATTACAGCGGAGTTTGGGCATCAGCAGACACCCTTGCACATCGCTAGTCGAAAGGGTCACAATGCTGTTGTCGAACTGCTGCTCCAGCATAACG
CGGCATCCAATCTGCCCGATGAGGAAGGCAACACGGCACTGCACCACGCAGCAAACATCGAAACAGTTGAAGTGCTCCTGAACAGTGCTTTCAGGACGAA
CGCCAACATCCCGAACAGACGAGGGCGAACACCACTGCACATTGCTGCCGCGCGTGGAGACGTAGCTGTGGTGGCTTATCTGATTCGTCATGGTGCCGAA
CAAGATATTGTGGATGACCAAGGTCAGAGTGCATTCCACCATGCTGCAGCCAACGGCCATACTGCGGTCACTCTGGTTCTGCTTCACGAAAACGACGCTA
CCAAGACTAAAAGCTTAGCTACGCCTGCTGATCGGAGCAGTGAGAACAACGGGGCGGCTGGAGATACTTTGGCGAATGGATCTCAAACGCAAACAAACAA
CACTGGCGAAGACAGTGGAGAAGAGAACGCAGAGGAGCAGGAAGAGGCAAGTGGATTCGACATCAACCAAGAAGACTTGAAGGGTAACACGGCACTTCAT
CTTGCGGCCATGTCGCCGTCCGAGCGGTGCCAGAAGATGCTCCAGCTACTGCTGGAAAATGGAGCAGATCCAAATCGGGCAAACTGGTTCGGATACACTC
CGCTGCATCTCTTCTGTTCTCACCAGAGCGGCCCAGCATCTCTTATCAGCGCATTTGTAAGTTTCGTATCTGCTTGGTCCATGTGAACCGTGAATTTACT
TTTACTGTCGAATTCGTTGTGCTGCGTGCAGATCGAGCATGGCGTGAATATCCATGCACAGAGTCTAGACGGTAGTACAGCGCTGCATCTGGCTGTTGGT
CGAGGAAGCGAGGACGTAGCTGTCGCGCTGGTAAGTGCCGGCGCTTTCGTGCACCTGCTGGATGCAGCCGGTCGCAGCGTGGTGGACCTCGTCGAGAGCA
CGAACCAGGGTTCAATGCTGGTCCCAGTCCTGCGCAACCTGTCGCATCCGCCTGAATGGATCGGCGATGAGCAGACCACGGAGTGTTCTTCGTGTCATAC
GACGTTCCGACTGGCCATGCGCAAGCACCATTGTCGTCATTGCGGCCGCACCGTGTGCTACAACTGTAGTAGCAACAAGATCGCCATCCCCAAGTTCCAG
GTGCTCAAGCCAGATCGCGTGTGCGACACGTGTTTCGACGTATTATCCTTCCGCAAGTTACTATAAGCACGAAGTTGCCATCAAAATGCAAGCACACAAC
GACAGCAAGCCCTGCCGTCAACCCTCGTCGTGACCAGATGGCTACACTATGCTCTGATTGGTCAATACTCCAGCATCGGTTCAATCCCATGTGGGTGGAC
ATTCAAGAACAAGAATAGCTCCTCAAGACCGTCGCCGCCAGCTCCGCCCGCCGCCCCCATTGTCGCCTAGAGCTTGCATCGTCCCCTCCTCGTGTCATGG
CAACTCGTGCTGAGGTGCCGCCGCCTGCACCCGCGTCGCTCGCGCCCGAAACGACGCCACAGGAGCCGCAAAGTGGGGACAAGGAGTTCTTCGTGCTGAG
CAACCTCGTTGGCGTCGAGCTGCGCTGCGTTGTGAACCCCAAATGGCCGTGCGAGGCGCTGCTCGGTGCGGCTGCAGAGGCCTACCAGGTCGCCTTCCCG
AACAGCGAAGTGCCCGAGTGCAACGTGGTCTTCCACCGCAAGAAGCAGGAGTTCCTGGTGGCCGGCACGCCAATCATTGAATGCTGCGCCAATCGCGACG
AGCTGGAGCTGGGCGTCACACTACCTGCGCGCGCTAGTGCAAACGTTGATGATGCAGCATCCGTTGCCCCGAGCAGCGTCAGCGGAGTCGACAGCGACGG
TGAGACGAGTGAGTTCTGTGTGCTCTTTCATAAACTGCCGCTGGGCTTTACCATGAAGCGCGGACATGACGGAAACACGGAGGTGGGCACCATTTACCCG
AAGAGTGCGGCGACACACTTTCCTCGCTTGACACCGGGCGTGACTATCGTCAGCATCGCTGGTACACCGCTCAAGGATATGGGCCTTCGACAGGTACATG
ACCTGATCAAGAACGCGGAACTGCCTCTGGAGATTCATTTCCGAGGACCCGAGCTGGCGCCGTCACTCACGCCAGGGCAGCAGGAAGCATCGCTTTCAAG
ACTGTCGGGGTCGGCGGGACCGCCGCCAACTCATCCTCAGCAGGGAGGGCGTCGTAGAGGGTCGTTTGACCGACGCAGTGTGCGGAGCAGCGGTAGCAAC
GGTAGTGGCCGCAGTCGCAACAGTCGTAGCAGCGGACGGGGCAGGAAGAAAAGTGGTGAGGTCATTCTTCAGCAAGGTGGTGACAATCAGCAGAAGGGCG
AAGGCGGCAAAATGCGGGTCCAAGCAGGAGCTCATACCGATGCCAGTGACTCGAATCAGCGAGGCGGGCCTGAGGAGCATGAGGCTGATAAGTCGGCTGA
GGCTGAGCTAGTGGAACAGATCGAGCAACTCAAGGTGGCACTGCTGCGCAAACACGAAGAAGCGAAGCAGATTGCGCGTCAGCTAGAGATGTGCTCCGAA
AAGCTTCTTGCATTGCGCGGTGAATCTGCTGGTGCGGTGCCTCGTGGCCAGCAACAGCAGCAAAAACAGCAATCCAAGCAAAATGGCACCCCACGTTTGC
GTCGTTCAGCCACGTCTTCATCGAGCAATGGCGGATCCAAGGTTCGCCTGACTCCTGAAGTCTTGGAGGCCATGGACCAAAAGGCGGGGCTCCCTCGGCG
TGGCACTGGTGCATACACTTCGTCGAACGTGTCTTCCATCTCGGGGTATTCTGCGCAGTCCATGCCTGCAGCTCGCTCTGCGAGCATGCGTGCCCGAAGT
GCTCGCGCGGCTGCTCTTGCCAATGCTGACAACGTGTCGGTATCGTCGTACACATCGAACTCATCGAATACGTCTGCACGTCGCGGTGGCAGTCGCTCGC
CTCGGGGCACGGCGCTACGGAACCTCAACAAGCGGTACAACTACATGCCGCAAAAGTATGCAGCGAACACAACGGGTGCTTCGGAAGGAGGGTCCACGTC
ATTGTCTTCGCGCGGTGCCGTGATGTCTCGTGCGCGCATCTCGCGCGACTCGTTCATTACCAAGAGCGAGAGTCCTGGTGTTGGGTACTACGACGTGCAA
GTCAAGGATCGCGTCAAAGGGGGTGAAATTGGCGACTCGGACCGCTCCCTGCCGTGGTCTTGAGCGCACTCAGTACGTCATCTGGAGATTGCATGGTAGC
AGTGTAAGAAGCAGTGCCGATGTTTGTCTCCTCCATATCATTGACGCATCGATAGGACACGACCATGGTCCTCGTTTGCTAAGAAGCCACACGCGAATTA
AATCAATAGACATGCCACTTTCATCAAGGTGAACGAGTGTGGATCGTGTTGTTATGAGCTCGAACTCCCTCGATGAAGCAAATGAAACCCTACACTGAAG
TGTTTGTAAATCTACTGAATGACGCATGGAGAGAACTCACACGCACGCTAGCGCCAACGCTACGCTCCCCTGTCACGGGAGATCGGGTTTGTATCAAAGC
AAGCCCAACCGCCCAGCAGGAAGAAGCCAGCCGCGACATAAATACTTGACTACGCCCTAACAATTATTCGCCTCCCTTCTCTCGATCGCTGCAGCTGCGT
TTGAAGAGGCCGCGACGAATGTCGAGAAGTTCCAGCACCTCAGAAGTCGGCCACGCCGGTAGGGGAGTCGTCCCGCTCGTAGTTCTTGTTGCGAGGGCCG
AAGGTCGCTTCAAAGTGTTCCCACACAGCTTGAAAGCACGGCGCCACCTGCTTCTCGTCGTAGCCCGTGAGCACGGACAGCTCGTCCCGCCAGAGTGGGG
TGACCCCGAGCGCCTTGCGGGACGCCACTAAAATACTCGCGGCGACGACTGACGGTCGGTACACCTGCAGCGAATACTCCTGTAGCACGAGGTCCACGAA
GAACTCTGCGTACTTGCAATAGTAGCCGTGCGCTTCGTCCACGAGCTCGGATCCCAGCAACCTGTCGTCGGCGAAGAGCACGGTCTGGCCAATGTAGTGC
TGCAGGAAGTGCAGCGGCGTCACGACCGTGAGTCGCCATCCCAGTCTGCAGGCACACAAGTACGTCACCAAAGCAAATTTAGCGCAAAGGAGGTTACGGC
ACCACACGTGTCCACTTTGCAGCAAAGCAAAACTCCCACTCAAAAGGGGGCCGTTGGTGGTTTGCTGCTGCGTGACGAACAATAAAGACCTCACGCACTT
TTGGAAGATGTCGGCCTCGGCGTCGCTGATCTCCTCGAACGAGTACATGCGGTTGCCCATCTCCCAGAACTCGGCCATGGGCGGCAGCTCCTCGTCCGTG
CCCAGGAACTTGAGCGCCATGCGCAGGCAGCTGAGCGCCAGCAGCTGGAACCGGTCCTTGCGGGGCAGCGGCGCGTCTCGGGCCAGCATCTTCTCCAAGT
ACCCCACGGCGGCGTGCACGTACTCCTTGCGCATGCGTAGGTGGGTCTCCCCCACGTCGGCCATCCACTCGACGAGCACGCGGCGGTACTTGACGTACTC
GTACTGCTTGGAGAAGTCCGGGCGCACGAGCTCCTGGCGCAGCATGGCGCGGTACACGATGTCCACGTCGCGGTCCTCCAGTGCCACAAGCTACGGAAAT
GAAATCATAGGACAATAATTATTGTCATAAAAATATTGTCAAAGTGAAGGGAGGACATGACGTACATTTTGCTCCTCGAAGGAGAGCTCGGCGGACCAGG
GCGCCTCCGACGCGAGCAGCCCCAGCACCTCGCCCGCCTCGGACTCTTGCGTGCTCATGAGGTCTTCGTCGTCCAGTACTTCGTCGCACTCGAGGCATTG
CGCTTCCCACTCCATGGTTGAGACGACGTGCAAACGGAAACTATCCCCTGTTGC