Description :
From Genome Similarity Track
Location :
Scaffold_19:54924- 56156
Transcript NameFunction/comments
Physo_568230anaphase-promoting complex subunit, putative
Physo_536507Hypothetical protein

Sequence
1232 bases(100 bases per row)
AGGTGCTCGTGCTTCCTGGTGGCAGTGGTGGAAATATCCGTGTCGATACCCCACAAGCGCTCGCAGCAATTTTGTTCCTCGCCAACTATTACAAGCAGCT
AGGTCGCTTGACCGAGGCCACAATCTTCTGCAACCGGTTACTGGACATGCAGGGGCCGGAAAAGGAGGAAGCCAAGGCACTCTTGCGCGAGATGCACAGC
CTCGAGGCAACTCGTATGCAATTCGCTTCGACGACAGAATCCTAGTGGATATGATCAGTCATATTTTGGTTACTATGGCGTTGAAGAGACTAAAAAGCGG
CACCGGTAAACCCGCGTATTCATCTTCTGTTGCTCCGATAACACAAAAGAACGATTGAGTTTGCCGATAACACCCCCAAAGCGTTTCTTTTCTCCGCCTT
GTGATGAGCTCAGCGCCACCCAAGATGCCTCCATCTTTCGTGCAAGCGCAAGAGCTGCATCGCACGCAGCAGACCAGGCATTATTTTGTTCTTCGGTAGG
AGCATGGAGCTCTATTGTCAGCTCTTTCATTGCTTGCATCTGCTGAAATCCGATTATTTGCTCAGCTTGGCCCAGTGGAGAGATGCCAATGGCGATAGTC
ATTCGTTTCATCTTGGGAACGGAAGCGCCACTCAACAACTCACAAATGCCACTACGCGAGAGGTAAAGTTGCGGCATGCGCAAGGATAACACCTCGCACT
CACGCAGTCCGTCCTCCAGAAGCCTCCCCACAGATGCGCTCACGCTGTGCGAAGTCATTCCATCGCGACTATAGTAGGCGATACGACATGATCGATGTGC
CGCGTAGTCAGCAATGCGACTAACTGTGTCTGCAATTTTCTTGTCGGTTTGGTTACCATTGCCTTGCACTGTGATGGCCACGTCAAGATGCTTCAATTGT
GCAAATCCACTTTGTAATTCGGCAGATAGAGTGTCCAGCAACTTATCTGAAAACAGGTTGCTGTTGGAGGACCACGTCAGTGTTTCCACTTGCTGTAGGT
CCCATGGTTCACCGGCTTGCCAATCCACTTCCATCGTCTCGGTTCCGTTAACGACGCCTGCCGAGGAACTTCTTACACCGCTGAGGTCAATCTTTTGCAG
AGTACTCCCGGGAGTGAATAGGCTATCCAGCCAGCGCGACTCAATGGCGACATAGTTGGAGCCGAAGTTGATGCTCTCCAGTCGATTGCTACCATCCGCG
AGGGCAGCACGGATATTCTCCTCGATCGTATT