Description :
From Genome Similarity Track
Location :
Scaffold_115:54903- 57027
Transcript NameFunction/comments
Phypl_g3472hypothetical protein
Phypl_g3473conserved hypothetical protein

Sequence
2124 bases(100 bases per row)
ATCAGTCGTCCATACAAGACTCGCGGGGAGATACACGTCACTTACGATGTGGATCATGCGCGCTTCGAAGGATTACCGGATGCGTGGCGAACTCTCAATC
ATCAGTTCGGGCTGCCCCTCGACAAGGTGCCGAGGCGGGAGATCGAAGGGTACGAAACCAAAGTACCCGCTGTACTGGAAATGATGAAAACCTGCTTTCT
AGCACACGACGGAGCTCGAGCGGAGGGAGTGTTCCGCCTGGCACCAGACAAGACAGAATACAACGCGGTCAAGGCTGCTATCAATGACGGATCGTTTGAA
GACTGCTCCGACGTCCACATCATGGCCTCGCTTATCAAGGTTTTGCCGTCGGTACTGGGGAAAATGTGTTGTTGATTCATGTTGGTCTCATTTTCGTGTG
CTGCATGCAACCAGGTTTGGTTTCGAGAGCTCCCAGTAGGTCTCTTCAACATGCTCCCAAAGAAGCAGATCGCTCTCGCGTGTGAGCTCGTGGTAGGACT
CACTGGCTGCAGTACGGATTTGAGTTTTTCCAGGTGCCGTTATTGACCGTTGTGGCGTCTTTTTTTGCCATAGAACCCGGAGCCcccggcggtgctgcag
tcccTGTCGACTCTGCCATCGCTGCATCGAAGCGTTGTGCTATGGCTGCTCGACCTGCTGAATGAGGTCGTAAAGTTCAAGCACGAGAACAAGATGACCG
CTAAGAGCATGGGTTCGTCCCGTATCGCTTCCACTGGCGCATTCATGTCATTGgcttgaccttcttcttcttctgcgatGTGTATCGCAGCAATTGTCAT
GGCACCGAACCTGGTCAGTGTCGAGAGCTCCGACATtgcggtcgtcgtcgcggcgTACCGACAAGTTGCTGACTTTGTGCAGGTGTTGCTGCATGCGCGA
CTGCGGCAGCTCTCGACTATGTAGATAGATGGCAAGGTCTTTAGCGAAGACGGTGGATGCAAGGTGGCGAAGTCGTTTTTTTATTGATATCGTTCGTTCG
GAATAATTTAAAGCTCAATGCAAAGAGGAAGAGGTGCAAGAGGTGCAAGCAAGCAAAAAGAAGGAGACCGCGGAGTGGACAAAGCTAAAGCACATCTACA
TCTAACCGAGCAGAGACTGCTGCGTCCGTCTAGACCAGGCAGCCGTACTCGGGGGAGATGTGGCGGAAGATGTCGTCCTCCAGACCTTCCAGTCCACGAG
GCGCGatcgacgccgacggctcTTCCGggttcgaggagctgctaGCTGTCGAGGTCTGCTGcgtcacggcggcggctttCCGCATGGCCATGGTgggcga
cggctgcagcggGAAGAAGTCGTACGAGACGGCGTCCAGGGAGTAGCCGCACGACGGGTGGTCGTTCTCGCCGTACGGGTCCatggtggaggtgctgaGC
TCGCCGAAGGGGTCGTACAGGGTGTCGAAGACAAAGCCCGGCTGCGCGGCGGGGAGCATGCCGGCTTGGCTGTACTGGCTGTACTGCATCCGGCTGTACT
CGGCGGCCGCACTCATGGCCATGGGGTTGCCGAAGAACAAGTTGTCGCGGTGCGGCGAGGAGGCtgaggccgaggacggcgagtcTGTGAAGAGGTGCTT
GCGCGCCTTGTTCCTGTGTACGAGGTGCTCGGCGCCTGGCCGCGGGCTCTGCGAGCCGCAcgagtcctcgtccgagtcgtggTCGTCCGGTGTGTGGCTg
ccgtcggcggcgtcgccgacgaagaagtggGCGGGCAGCATCTGGCCGAAGGGGTCGATGCCGTAGGTCTCGGGCGACAGGAGGCGCTTGAGCTGGCTCT
GGTAGCCCGCGAACTGGCGTAGCTGCTTGTCCGAGAGCGGCGGGCCGGTGCcgtcctgcgcctgctgctggcactgctccagctcctgcagcgagcgctt
gagGCTGCGCACCTTGCGGTAGGGCCAGTGGCGGATGCCGATGGCGCGgcagcgcttcttgaaggcCGTGGCGCGCACGCCGAActtctcggccgccacc
TTGAGCGGCAGGTGGAAGTGGCGGCTCAGCGCCGTGAAGTTGCACGTGGCCacgggcagcggcgacgccgagccgTCCGAGGCCACGGGCGAGTCGCAgg
ccgcgcgcttcttgaagttGTAGG