Description :
From Genome Similarity Track
Location :
Scaffold_2845:549- 2750
Sequence
2201 bases(100 bases per row)
GATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGGAGGCCGATCCACCAGGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGTGGCGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAAC
CATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCGTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACCGTAG
GTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGT
CTTATCCGTCCTTATGATCCTCATCTTTGCTCCATACAACGGTAGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCT
AGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAATCAATACACCAAAC
AACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCTCTACCTTG
GCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATTCAACATCCTCAGATCCACGGGATC
CAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTC
TCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAGCTGACACTTCATGTAGATCA
CGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCG
GATTCCAACCCGGCGAGCGTCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCTTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGT
AGAATCCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACATGTAGAAGCAATGATCCCTGGGATGACCTTTCTTGCCACACTT
CTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGAGATCCGCACTGCGAACACCTGATTGGCGCTGTCCCGTCCATGAGATCTCGGGAT
CTGTACATCCCACGGTCCCCGGGTACGGTATCGGCAGTGCGGGAGTTGTCTCCAGTCTTCGCTGTACGATCGTTGGGCGCAGTGAGACAGACTCGGTGGT
AATCCTCTGGGTCGGAGTCCGAACTGTCGGGTCCTGATTCAGTTCCTGAGTTGGGCGCTGTGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGTCGG
AGCCTTTTGGCGATACTTACCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCG
GGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTAGCTTGGATCCCCCATCCT
TGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAACGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGC
CACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTG
GCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATTCATGTTCTCG
C