Description :
From Genome Similarity Track
Location :
Scaffold_274:549- 1879
Sequence
1330 bases(100 bases per row)
CGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTTAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGG
ACGCAGCTTGGCTGATCCTCGGCGATGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGA
TACGATGAGATCCAGGTCTAGCTCGAAGATATCCCCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCC
ACCAACTGGGTGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAA
GTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGGGCTTGCATC
TTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCATTTCTTCGACTAGCGGGGTTGGGTTTAGATACAGTGTTGGCTTAACCGGTGAATCTGCAA
ATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGATAGCGGATCTCGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGCGGACTTGGGGGGGGGATAG
ACAGGTTTTCCTTCTAGATCCAGATACACCTCTTTTTCCGTCGAGAGAGTTCCTCCCATAACTCCATCGATCCGCGGATCTTGTTTCCAATCAGCAGCGT
CTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGAT
CCGGGCACGCGCACCATTGTGGTGTAGCGGGATTAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGG
GTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACTCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAGCTTCCGAAGAGTTCAAGTG
GTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATA
TTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGACCGTAGGGTTGCCTTGCGGATGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCG
CCTCCTGTGACGGGATCTTGAGAGTTGAGA