Description :
From Genome Similarity Track
Location :
Scaffold_16:54899- 66668
Transcript NameFunction/comments
Sapdi_VS20SDRG_05870hypothetical protein
Sapdi_VS20SDRG_05871hypothetical protein
Sapdi_VS20SDRG_05872hypothetical protein
Sapdi_VS20SDRG_05873hypothetical protein
Sapdi_VS20SDRG_05874hypothetical protein
Sapdi_VS20SDRG_05875hypothetical protein

Sequence
11769 bases(100 bases per row)
CAAATTGGGCAACGTCGACGGGAGCGCAATGCCGGGCAGCGGGCTCAAGCTCGTGCTAAAGAAAATGTCGTACGACACGGGCAGCGTCGCGTTGAGCGAG
AGGTCAAGGTTGTACACCACGGTCACCTGCGAATCGTTGAGATTGCAGTTTTGAATCGTCTTTGCAATGGCACTCGGGAGCTGCGACGCGGTGAACGACA
CCACGCACGGCATAAGGATCGTCGACTGGTTGACGTCGCTCTTGTACGGTCGTGTGACGCTGACGTTCAGCGGCAACGCGTCCGAGAGGCGATTCATGCG
CAGCTGCGTCCACCCGACCGCCGAACTATACCACGCGAGCTGCGTCGTTCCGTTCGAGTCTATACATACAGACACACTATGACACTGTGAAGGTGCGCTT
GTTTGTACAGAAAGGACAGGTGCGCGCGACGAGACATTGCATTGCACTCGTAAAGAGGGTGCGGCTCGGTGTCGCGGCCGCCGGTGTGATCATGCACGCT
GTGATGTTGGGCGTCACATCCACAACGCTTCCGATCGTCGAGGCTGCGAGAACGGCACTGGCATTACGGAGTGATTGCTGGGCACAAGAGAGGAGCGACG
AGCAGTTGGCATCGGCGCTGCAGCGCGCAACAAGCGGCGTGCAGAGCGCGCAGGCCTCGGCCTCGGTGGTCGCATACGAGGCGTTGCTCGGTGCGCCTTC
GTGGAGGTGCACCAAAAGCGACACCTCGTTGCTGTTGCGGATGTACGCGCGGTAGTCCGTGTACATGGGCACCTGGCTACTGCTCGTACTCGTGATCGTC
GACGTGGCTTCATTGGCGCTAAGCATCGCGGCCGACACATCAACGCTGATGGTCGCCTTGTCACTTGCGCGAACCAAGTCGAGCTGAACGTGGTCGAGGG
GCGCCGTCATCGCAGAGCCGTAGAAGGTCCAGACGCTGGCGTTGCCGGGCGGCACCCGCGCCCCCAAGCCGCTGGCAAAGACCGTGCCGTTAAGAAAACT
CGTTGCCTTGACACGCGAGAGGAAAAAGCTGTTGTTGCCGGCACTATTGTTCCACACCACGTGCAAGCACCACGGAGCCGGACACGGACTCGGCGGCGAC
GAAAACACTGGTGCGAGGGCCGTGTCCGAGACTATGAAATTCGTAATCACGGACGTGTCGACGACGCCACCGTCGATGGCCGTCACCACTTGCGCCGGCG
TTGCATTGATACTGTCGACAGTCACCATGAGCCCGAGGCGCACCGCGTCGTGAAAGCCGTAGGCGTCCATGAGATCGGCGAGACGCAAGAAACCACCGGC
CGGCAACGGCTTGCCCTGCACGAGGAGGTTTGTGATTGTGCCGGGCGGCAGCGATGTCGTGTTCAGCGGGATCCCGTGCACGACGAGCGTCTCCATCAAG
CTAAACTGAGTCGTGTTGCTGACGGCCAACGGCGCGAACCGAACCGAGGACGAGTTGAGAAGGTCTTGCATGGCCACGCGCATGCGGCAGAGCGTTGCAC
CGGAAAAGTAGACGCCCTCAAGTCCGTTGGGCGATAGAAAGCGGAGCGTCACGAGGAGAAACGGTGTCGTGCCAAAGATACTGGTGACGGTCGCCGGCGG
GTGTAGCCCCAGCCACGGGGCCGTCGGCGCGGTGCTGACGTGATTGGTCACGATCTGCGAAGAGATGTTACCAATGTGCGACGTCAAGTAGCCCCCGACG
TCCCCGATTGACGTGAGGAAGGCGACGAACGCGTCGCTCGTCACGTTGCCGTACCCGGTCGCCGTCACGGCCAGCGCGACCTCATACGACTGCGCGTCAC
TCAGCGAGGCATTCGGGCCCGCCAAGACGTCGATGGTCTGCAGCGCGACATCGACGTTGGAGGCGTTGAGACTGCCCATGGTGACGGGCAGTGCAAAGCC
GCGCAGTTGCGTCACCAGCGCATTTTCGCTTGCCTCAATCACAGAAAGCAGCTCGTTCTGCCACGTCAGACTCACATACACTACGAGGTTGGTGGGCGAC
GGTGCCGTCTGCGCCACTACGGCAGCGATAGCCACCGAGAACCACCGCAGCCATGCCATCGTTGCTCGGTGTTGACAAAGGAGGAATCTAAAGTCGCGCG
ACCTTTCCTCGCCGGCTCGTCTATCCGGACAGTGTCCGGAAACGCGCGACGGCTGCGACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTGGTGCCGCTCGTGCCGACGCGGCCGCCACCCCGGTCAAGTGGGCGCACCCAAGCCAAGTCGCTCAGTGCCGCGTCGACACCCGAGGCGGGCGCCCCCC
GCGTCCGGCGAGAGGGGGGCGCGTCCAAGCGGCACACGGTGCTTTTGCCGCAGATCTCGGCGCCCGACGAAAACAACGCGACGACGTTCATTACACGTAT
GCACGACGCAACACTCTGTATAGGGTTTTATAGCAGGCGACTAGATCTGTGGCAAAAGGCCGATGGGGAAGAGCTCCGTCCGCCGTCGCCCTTCGAGGAC
GAGCGCGAAGAGTCGACAGCCGTCGACGCCGACAACTACTTTGGACTCGACGCGCTCTCTCGCTTTTGGCGCATGTTTCAGCGGCAAGAGACAACCGCCC
GCACCAAGCGGCCGCGCCCGCGCTCTGCTCGGTCTGCCTATCACATTTGACTATATTTGCTCAAGGTAGAGTGTAGCACCACGTACCTTCAGCGGCTCCA
ACAGCTGCACCGGTGCCCCGAGCCGATGGGGATCATCCGCAAAGGCGAGACGCCCAAGGTTGATTTGCAGTACGACACCGTTGTCGCCCACTTGTCTCTC
TACGAGTATGTACGTGTAGCGCCTATGACATTGGCAGTGAGTTTGCGACCGCCATGGGCGAGAGCTTGGCGCTCATCCCGAGCATTGATACGCTCAACCT
GGCGTCGAACCGCATCTCGGACGCAGCAGCCAGCGACGTGATCGCATCCATGGCAGCGTCGCCGACGCTGCGAGCCCTCGATTTCGCCGCCAACGACTTG
GGGCTCCAAGCCGCGAAGGCGCTTGCGACGCTTCTCGGATCGACCAAGTCCCTTACGTCCATCAACCTCGCCCACAACAAGCTCAACAGCCGCGCGATCG
TGCTTCTCTGCGATGGTACGCTTGCTTTACGGCGCTATGTCGTCAGTATGCGTAGCGCTCAAGAAGAGTCCGACCGTGACCCACCTCAACATTTCTGAAA
ATGCCTTTTCGACGCCTGGTACGTGGCAACATGGGATCAGCGCATGGAAGCGTGGTGTAGGCATGCTGGCGATCGCCAAACTCCTCGAAGAAAGCGCCAA
GATCGAAGAGCTGTATCTTTCGTGGAACAAGATCCGCGGGATTGGCGCGCAGCGGATCGTCGAGGCCATCGGCTTCCACAACTCGCTGCGCGTGCTCGAC
TTGTCGTGGAACAGCCTCAACTCGTGCGCGCACCACGCCGTCGCCACCGCCCTCGCGGCCGCGCTGGCCAACAACAAGGTGCTCGTGCACCTAGATTTGA
GCAACAATGGGCTCGACGTCGACGATTGCGCGATCCTCGCGAACGCACTTGTCGCCAACCACACGATCCTCGGGTACCTGCGCCTTTTGAAGGCCATTCG
TAGTCTCGCATTAGGACGTAAACTTTCGATGCTAGGCTGCACATGGTTGGCAACCAAGGCTACGTTGACGCCCGAGGTATCGCCCTCTTTTTTGAAAATG
ATTGAGAATAAGTAGGGTTTGTCGTGCCATCGACCGAGCCGATGCACTTGCAGGCGCAGCACAAGGTGTCGAGCATTGCCCACTACGAACAGTATCAAGG
GACGGACGAGAGTGCGTACGACCATTTTTGGCACTGCGTGGACCGCCAGTGCTGGCTCTGCGGGCGCTGGTCCGAGTACCGGTTTGTCTGGACGCCGCCG
CACTCGATCGACCCAAAAGCCAAGGTGCAGCTCCATCTCTCGATCGACGACTGGGATGGCGACACCATGAGCCCGGCTGCGAACGATACGTATCTCCTGT
ACCGCATGCTCCCGCCAGGGAAAACGCAATACTTTATCACGGTCTCGACCGACATTGCTGTACGACTTGGACCATTGCGATAGTTGAATCATGGCGTGGG
GTAGTCGTCCCTCTCGAGCAGTGGCGGCACGTCAGCGCTGCCCGCGAGCACGCGTACCGTGCGGCAGTTTTACACGATGAAGGACAAGCGAGCGTCCCGC
ATTCTTCGGCAACACGGCGACGAAGACATTTTTGGCACCCTTCACGTACACTATTTGTTGTGAACCCGAACCCTAGAGAATTGCGTAGTACGCCAACTAT
ATCGCCATGTCGCGCTCGGACGACGCCAACCCGTGTCGCGCCACCATGCCGCGGCCCGGCTCGAATGCAGTCAAGGCACTCAAGTGGGACATCAAAAAGT
CGGTGTTTGCATCGCGCGCCAAAGAGAGTCCCAGCAAAGCTTATGTACATCATGTACTAACTACGTTTTTTTCTAAAGCGTATTAGGTGGACACGGACAT
GCTGGTTGCCAAGGCGTTCCTTGTTGATTTCAAGCACTGCAAAATCGACCGCATCATTCGGGACGCACTTCGAAAGAAGGAGCTCGAGACGATCGGCGTC
GTCTACTACCGCGTGATTAGGTACACGATGACATATTGTCCACATCTGAGACACGATTAAACTAGCAATTTGTACCGCACGTACTGCAACCGCGGGGTCC
CAAGCCGGGGCACGGCCATGGACACGATATCGATTTCGTGGGCCGGGTTTCTCGAGTTTATCAATGACAGCAAGCTCGTCGACGAAACCTCGGAGCGCTG
CAAGATGAGTGACATGGACAACGTCTTTGTCGCGGCCAACCTCGAGGTGACGGAAGAAGCAAAGCAGCAAGACAACCCGGACCGGAGCCTCACGCGCTTT
GAGTTTCTCGAGTGCATCATCCGCATCGCGATCAACAAGTACGCGACGGGCAAAAGTGCGTCTCTACTAGCTCGAAGGATGCTTGACGGTACACTAGGTG
CAGTGTGCGAGACGCCCGCGCAGGCGTTCGAGAAGCTCATGCAAGAGCACTTGGTGCCAATGACGCCCCAAGATAGCAATGAATTTCGAGCCAACTACCT
CTACACGGAAGCCGTGAGCGACTGCCTCGTCGAGTATGTGGTCATGGTAGGACAATGTGTCCAATCTAGACTATGCATCAACACGATGTGTAGCTCAAGG
ACCTCTACCAAGACAACAGCGGCAAGTACTGCAAAGTGGGCGACGTCAAGGGCATGGCCATGCAAGAATTCATCAATTTACTGTACGCACATTGGATATT
GTCTAGTATTTATGAGACACTTTCGTGCGTAGCGAGCAGTTCCACGTGTTTGACGACAAATTCAAAGTCCGCGACGTCCGCGAACCCTTTTTCGCGTCCA
AAATGATGATCCTCGACGAGATGGCGTCCACGTCCCAGCGACGCATCATCTACTTCACCGATTTCCTTGAGCTCTTACTGCGCGTGGCGTTGCTGCGGTA
CCCGCCAGCGTCCGAGTCGGTGCTCGACGCCGTCCACTCGCTCGAACAGCTCTTTGTACAGCACTTTTGCGCCAAAGACCAGCTCGTCTCGACGTTTCGG
AGCTCGGCCGAGAAGGCGATTGCAGCGCGGCTGCTCACAACACCTCCGACGTCGGCCCACGACGATCCGAAAGGAGCCTCGCCCCGGTCCCGTGGCTCCC
GGCGAACGTCCCGAAAAACGCTGGCCGACGTGCCCAACATGAGCAGTGACGCCAGTGACAGCAAGCGAGGCCCGTCCCGATAGAAGTAGTAAGAATACCG
TCCTCTCATTGTTGCGAATTGATACACCACCGTCCCGTTGTTCATTCCTCGCACTGGATCGAGCGTGGCGGGCGGATACCGATAGCTTGATAAGTTGATA
CTTGGACTTGTGGATACACAACACATACGAGCCGAGGATCGGAAGACACACGCGTGCGAGTCCGTCCTACTGCTCGCATCGTCGTTGTCCTTTTGAGATT
GTTTCATACAACAAACAACGTGCCTCGACCGCACGCGCGCTTGAAACAAAGTCAGAACTGGACCTCAAGCCAGAACTGGTCCCTAGAGTCAGAACTGGTT
CCGAAAGTGAGAACTGGTTTCCGGTCCACACACCTCGACGATCATTCAAGGTGCTGGCTCGTTCCACACCGGCGTGTCAAGAGGAATCTTTGTGGTTCTT
CTCTTGGACAGTGTCGCCTGCATAGCTCTCTTTTAGCAAGATCGCGACAGCAACAAGCAACGGAATCAATCATCAAGGTGGTTAGTGTAGAGCACCAAAA
TGCTAGCGTGAGCGCTACGCGAGGCGCGGCGCGAGACCCATAATGTCGTGCAGCTCGGACAAGAGGGCGTCGTACGTCTCTCTTCGGCGCACGACGATCG
GGTCGTTGGGCGCATTCCCCGATTGGCTCTCGACGTACTTGAGTTGACGCGCAGCCTGCTCCTGCTCGTAGTCGCCAAGGCGCGCATTGGCATCGTCCAG
CATGCGGTGGAGCTCGTCGACTTGGTGCTTGAGCGCATCGACCTCGTCGCACGACGAGCCAGACGAGAGCGACGACGAGAGAAGTGACGTGCGCGCGCTG
TGCACACTCGCGTGGGCGTAGCGTGCACAAAAATCATCGGCAAAAGACTCGAGCAGCGTCGCGTGGTCCGAGCGGAGGTCGTCGTCGTCCTCATTCCCGT
CCTCGCATGCCGTCTTGGACACGTGGTGGTGGCGGGTTGACGTCTCTATTGCGGCTGTGAATGACGGCGGCTCCGAGCGCGGCGGCGGGGCGATCCCGGC
GATGGCTTGCTTGATCGACGAGATGCGGGCAACGAGCTCGTCCAGCGGCACAACACCATGGCTCGTCTCATCGATGACCTCAGGAATCGGGCGCATCGCA
CGCTGGGACGGATACAAGTCCTCTAGCATCGCGCGCATGGGCAGTCCAAGCGACGCCTTCTTCGTCGTCGGTGGCGGCAGTTGCAGCTGCATGTCTTCCA
GTAAGACGATGCTCTTCTTGTGGCGCGGTGCGATGCACGGGGGCGGCGGAACGGCGTTGGCTTTGCCAATGCACACGTTGCAGAGGCGGACAGGCAGTAG
CCCGAGGACCGGCACGTCCAGCGTATGGTGGTCTGCACACGATGCGCAAACGACTTCGCCGCACGACCGACAGTGGTGCTTGCGACGAAAATGAAATGAT
TGTAGACAGACTGCGCAAAACTTGCGCTGACTGTCGGGCACCCAGAGCGCTCGGTCGACGATCGGCAGCTGACTCAGTCGGCGCTGGGCGACAAGCGGGC
CAAGTGTGCTCAAGCACAAGAGGCGCTGGGACAGCGCGCTTTCCCACTTGTCCATGGGCACCTCACGCGGCGACGACGAGGACACGAGGTACGTCACGTG
CACTATCTCGGGGGACGTGGCCGACGGCACAATCAGAAACCCGGTGCGGCGCAGGCTGTCGCGACGGTAGCCAAACGTGCTGAGCGACGGCACTTCGCGC
GGCCGATCGATCGAGTGGTTGACGCAAAAGCCAATGTGTGGCCCGCCATTCGGCGGCATTTGAAGCCCCGCGTACTCGAGGAGGCAGTAGTCGCGGCCGA
GCGCGGGCCCGACGTCGTCCTTGAAGGCGGTCCACTTGACACGCAGCTCGTTGTTGACGTCGTCGCACGCGACCGAGGCAAGCACAAGGCCATCGATGTA
CTTCTTCGCATGTATGCGATGCATCCATCGCCGCGACTCGTCCGTTGTGCTCGGTGCCACAATGGCGAGGACCTCGGCGACCGTCGCGCGGACGTTGATC
GCGCCGCGCATGACGAGGCAAGGCTTGCCACCCCTGGCGTCGAGCTCGTCTTGCTCGATGCAGTGCACTTTGCCCACGAGCAGGCCGTCGCGGCTCTACG
CAAGCGATGATAATGGCTTGCAGCGCACCAGCATCCTACCTCGCATCGCTTCCACGCATACGTGGCAATCGCATGCTGGAGGTCGTCGAGTGCGTAGCGC
GCCACTTGGCGGTACGTGGCCGCGTCCGCGCTCGTGATGGCTGCCGTCGGAAAAAAGGTCGGCTTGACCGGCACCTCGAGCATCTCGCGCTGACCTTGCC
GCCGCTATATGTCGCAAGCTATTCTTGCTTCAGTTTCGTTTTAGACGGATCTTGCGCATCATTTTATTCGTTTCTGGCCTCTTGACGGTAAATTACTATA
CTTAATTGAGTCAATGAATTGAATTGAGACCACCAGCTGGCCAGGTGGCAGCACGAGAATGAAGCTGACCACAAAGGACGCCCGCCACGACAGAGTCGCG
CTAGACAGTGCAACGCAGCCACCATGGTGGGCCATGTTGGGTATCAATCCTACTCGCTTTGGTGGGCAGTGGTGGCGCCGACGACGGCGGCGGCCTCTAG
GATGCGGGATACTGATGCGGGATGGGCACGCTGGTTGAGATGAGATGCAGTGCGCTCCACGTCGTCTTCACCTTCACGGTTGTCGGTTGAACTGGAACGA
AGGCGTCATCTCGCGATTCACCGCGGGCGTCAGCTGCGCCAACGCCGCACCGATCACATCGCCACAAGTCGTATCAGGGCGCACCGTCGTGAGCCCAACC
GGTTCGTCGCCGCTGCCGTCGTGATGGCTATCGGCTGGCGTTACGAAGGTTTTTCAACCCGCTTCGAATGGGAGGGTTCAAAGGCGAGTGGTCAGCTAAC
AACGACGACGTAGCGTCAGTGATTATACGCTGATTACAACTACGAATGGCAGCCGACGTCGTCGTGGTTGTACTGCTTACTGCTGCGACGGACTGGTGGC
CTTGCTCGACTTTTGGCGCGACTGGACTTGCTCCAAGTCGAGCTCGCGCCGACGAATCTTTTTCGAGACCCACGGGTTCTGGCCTGTTTCGGTGCGCGAC
GGGTCTCGCCGGACGTCGGGCAGCACACCGATCGTACTGGGCGCCTCAATCCATGCGTCGGGCGACGACGTGAGCTGCGGAAACCACTCCTTCCGCAGCG
CATCCTTGGCCGCGTCTGTCAAGTCGCCGCGGAGCGCCGGGAACCAGTCGATGAGTCGCTGGCACACGAGTGCGGTCGCGACCGAGAGATTCAAACTCTC
GCTAAACCCAACCTGTTCGATTCAATTTCGACATGCTGATCGCCAGCGACGCGCCTACCGTCGGAAAGTAGATGCGGCGGTCGGCTTCGTGCAGCATTTC
TTGGCTCACGCCGTCCGTCTCGCGGCCAATCACGATCGCGATGCCTTCCAGAGGAATCGTCAGCGTCGCCTTGTTCTCATGTGTCAAAGCTACGGCTTCC
TTGGAGAGGTCCGTCGCTAGAGAAGATTGACATATTGTGAGCCCTGTATCCAAGAGGCCGTTCGTAGCATACCCCAAATGTGGCGTCCGTCGCGGCGCAA
GGCTGCAATGCAGTCGGCGATCGTGCTAAAGTGCGTCACGGAGAGCCACGTGCCGCAGTTCTTGGAGACCTTTTTGGACCCGACTTTGTGGCGGTTCTTG
ATCTGCTCGTTGTTGGGATCGATGACATAGATGGTTTGGATGCCAAGCGCTACGCGTCGTGTTGCAGTGAGTCTTTTCTGACAAGAGGACGAGACTGAGG
CACCTTCGGCCGTCCGAACCACGGCTTGGTGGTTGTGCGAGTCAACGCACTGCTCCAAGACAAGCAGCAAGCCATCTACATAGCAGTGCAATCGTCCCAT
TAGTCGCGTCTAGACGAGGGACATCCTCGCACGACGTACGCGTCCGTTGCTGCAGCACTGTCTCGGCACGCTGGAGCCGCAGCGACGCCGCGCCTTCCGT
GCTCATGCTCCCAGGAATACGACGAACCAATGTCCGAATCGATGCCATTGGCTGAAATCGGACTATCGCACGCGTCTGATTGGCTACTACAAGGGCAATG
TCAGAAAGGCCCACCGTTTCACGCGCGCGGGGCGAGCAGCGCTGTAACTCGCGGCAAACTCACAGCGCAGACGAGGATAAGTCACGAGTACGTGCGACTC
GCAGCCTCGTATTATTACCGCCTGACGACACCACGACAACGACGCCCTTGTAAAGACACGGCCGGCGTCGTTGCCAACAGGGCGGGCATGATCGTCGCAC
GCTGCCGCATCACCATGCTCAGGAACAGAGGGGACGATGGGGTACCGGTAGCACTCTAGATGACGCCCCATTTGGAGAGCACATTGCTTGGTGGGTACGC
TCGTGGCAGATCAGGTACCGCATAGAAACGATAAACGCGCAAGGCGTCGACGACGACGACGGCCCTGTCTACGAGGGTTGTATGAATGTGGGATATTGAA
GGCACGGCGATCCAGCGTGGGTGACAACGTTGCGTGATCCGAGCGCACCTGCGTCGGCACCTGGTGACGACTGGCCGCCTTCTTTGTGGACGCAAGGATG
CACGCTAGTCAACAAATTGCGTGCGCGTTCTCACGCGCGTGCAATAAAGAGGGGCATCATCAGCACACGCTTACATCAGAAACGTTCACACTCCCACGTC
GCACCCGAGCTGGTTCCGAGATTCCCATGTGCATAAAGTCCCAAGAGCCTCGAGAGCGCAACTGCAGCGGGACATACGGACACGAAAGGTGGTGCGCATG
ACAGGCGAGACGTCACTTCTTATTGCAGTGGTTTCCATCAGGTGAGTCTTCGCGGACGAGCGGCTCTTTTCATTTCCCATTTCCCTTCCGAGCGTCCACA
TGAGCAGTCCGTGCGCCTTCAACGCTGCCAACGTGCAAATCCTCGAGATGGACCTCTCCCTGGTACACGATGGTGCGTTTGCATCCAGCGCCTTTGACGC
GGCCTTTGTCACGCTTCACGCCGCGCATCCGACAACGTCGTGGATAGCCCTCGACTCGATCAACCTCTCGTCATCGAGCGTCTCCAAGAATGCGCCAAAC
ACACCGACAAAGGCACACGCGCCACGCCGTGCATAATCGAGATTTCATGTGTAAGTATTTATGATTTCCATTCTTTAAATAAAGTGGTGTGTCGTTTCTT
GTTGGGATACTTTGTACAGGTTGTCTTCGAGTGACAAGGTTCACGCTGCCCAATTTAACACGGCTTGGCCATATTGTACTGCAGTAGGCATTGGCCTTGT
TGAACGTCGTGGGCTTTGTAATCTTGTTCATTTGGCACCGAAGGACAGGATAGCAATGTATCAAGTTGGACTTTGCACTTCCAACTTGTTGCTGTGCTGT
TGGACGTCTCCCGTAAAGACGTTTAATGATGGCAAGATTGGAAACGAATTCCTGCCATGATTGTACCGGTGCCACGACCTAGAAGTACCCTAATTCCTGG
CGCCAAGGGCCCTTCATTGCGATGCAGCGGCCAATGTGACGTTGCCGTGTTTGGATACTGTGCAACGTACGCTTCGCTAAGATTCTCGTGACGCGAGACT
GCCACGTACCGCACCCGTGTAATCGCATAAGATATCGAATGCCAGAGGTTTTTAACGTTGCGTGCTGACAGCAACGGCATTATCATATCCGGCCGTCTTA
TCCGGATACGCCGGCAACCAATTCATTTTTACCGACAGCGACGCGATGGCACGCGGGGTACGCCGCCAG