Description :
From Genome Similarity Track
Location :
Scaffold_784:5488- 7089
Sequence
1601 bases(100 bases per row)
AAGCACGACCTCGACGCGCGCCTCTCGTACGTGAGTGCGGCGTCGCAGCCCAAGGATGGCGAAGGCTACAAGTCGGCCGCGACCCCTGAGGCCATCGAGG
GTGGTGCTCTCCGTGAGGGTGGTGCGCCGAACCTCCTCAGCCGCGACAGCATCGGTCTGCTCTTCCAGTACGCCGCCGTCGGTATGACGTACGGCATGAT
GCCCGCCACGATCTACCCGCTGCTGCAGTACTACCTGAACGCGTCGGGCACGCGCGTGACTGTCGCCAACCAGCTCGTCGTCTTCCCGTGGTCGTTCAAG
GCCTTCTACGGCGTTCTCTCGGACTGCGTTCCCATCTACGGTTACCGCCGCAAGCCGTACATGCTCATCGGCTGNNNNNNNNNNATCATGCTTCTCGTCA
TGGCTTGCCAGCCGGTTGGTGAACCGTACTTCTCGGTGTACACGGACCGCGACATCGACCCCTCCGACTACACGGACGAGATCCGCGCTCGTATCAACTA
CGACGCCGCCAGCCAGTCTGGCAAGTACGTCATGCTGATGTTCTTCGCTGCCTTCGGCTACGTCATGTCGGATGTGTGCGCCGATGGTATTGTCGTGGAC
ATGGCTCAGCGCGAGCCGATTGAGATCCGTGGCCGGACTCAGTCGATGATCTACATTGTGCGTACGGCTGTTGTCATCTTCGGTGAGATCATCACTGGTT
TCCTCTTCAACGGCCATGAGTACGGCGGCGACTTCGACTTCTCGCTGTCGTTCCCTCAGCTGATGATCATCTGCACGGTGTGCACTGCTCCTGTGATCCC
GATCACCTGGTTCTTCATCAAGGAGGAGAAGAAGCCGCGCGTCAACTTCAAGGAGTACATGAGCGACCTGTGGGAGCTGATCCAGAAGCGCGCTGTGTAC
CAGGTCATTGCCTACACGTTCTTCGCCGGCATCTTCGCTGGTATCACGTACACTGCTTCGTCGCCGGTTGCCTCGTACATGATCGGTGTGACCCCGCTGA
ACAACACCCTGAGTACGATCCTCGGCAACCTGCTCTTCATGCTCGGCATCATGGCGACCTCGAAGTGGGGCCTCAACTGGAACTGGCGTGGCATGATCGT
GCTGACTGGCGCGTTCGTCTACGTGATCGACTGTGCTACGACTCTCATCTCCGTGTGGGACGTGTTCCGTTCGCAGTGGTTCTGGCTCGGCCCGCCGATC
GCCGTCCAGGTGCCGTACGGTGTCGGCTGGATGATCTCGAGCTTCGTCATCGTCGAGCTGGCTGGCGTCGGCAACGAGGGTGTCATGTACGGTCTGGTGA
CGACGGTGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTATGATGGTCTTCAGCT
GGGCCTTCCTGTTCTTGTTGCCGCGCCAGAAGGAGGAGACGCAGGAGCTGCTGCGCACGGGAGGCTCGAGCAAGCTCTTCGGCGCCCTCACGGTCTTCTA
CATCGCGTTCGCCTTCGTGTGGTCCATCATGACCAACATCATGGCCATGTACGACAGCACGTCGTGCCTCATCATCGCTGGTGGCTCGGGCTGCTAATCG
C