Description :
From Genome Similarity Track
Location :
Scaffold_126:54872- 59570
Sequence
4698 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTACTATGTGTCGTCGCACTTGGTAGCACTTGTAGTCAATCCACGCCAACGCGGGTAGACTACCTGAACCTCTCTGAAGTTCG
TTGCCATGGATAGGAACGACTTCTCCCATCTGAACGACTCACAGCTCGAGTCGGTTCGGAAGATGGCTGGCATCTTCGGGATGGAGGCCCTGCAGAGCCT
GGTGGCATCAACACCGGCCGAGCAGCTCGAGCGCATCAATGCGTTTGACGCTTACGAGCAGGGGCTCACGCACATATGCGGGAAAACCTGCAGGCTCCGG
CGGCGGAGACAAACCCGCCAAACCCGAAGCCAGTTCGGCTGAATGTTAAGCCGTATGAAGGGAAAGAAGGTGAGAACCTTCCGTTCTGGGCTCGAGAAGT
AGAGCTCGCGATGGACGCGGCTCTGAGCTCGACCGAGCAACTCCGTCTTGATTTTGCACTATCCAACCTAAGCGGTCGTGCTAAGAGCTGGGTGTACACG
CGGGAGACGCCATCCCCTGGATGTTTCACATCCTGGGCTCCGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCAGCGAACTACGAGTACCGGCAGCGTT
CGCGCTTCCTCTCATGCAAGCAAGGAAGACGCGAGCTGCACGAGTACGTTCAAGAGATGCGAGAGCTCATGGCTTCTCTAGTGGGCAACTTACTTAACGA
ACACATCAAGGTGACTGTGTTCATGGACGGCGTTGGAGTGGGCCCGGAGCGCACTCAGCTGTTCCGGGTGCAGTCAGGCACCCTCAAAGAGGCGATTCAA
GCAGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGCACGCCGGCCTCAGCGTGGCCAGGAAATTCTGTGCCGAATTTCGGCCGGGCCAACCCCACCG
GGCCAGTTCCCATGGAGCTCGGGTCCGCCGAGCAGCGCGACATTTGCTGCTTTGGCTGCGGGAAGCTGGGCCACTTCAAGCGTGACTGTCCCGCGAAGAG
ACACCGCAGGCGGACGTTCCCCATGCCCGTCTTCAAGGGACGCTGGCAGAAGCCATGATCCCGGGGACAGGGGACCACCGGAAACCAGTAGGGGCGGGGC
GTCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGCACCACGGGAACTTATCCCTTGAGAGTCTTTGCACCCTGGAATCGGCGAA
GAGCAGCGGCGGGCTGTTCGTAGTACACAGATGGGTACGCGGATACGACCACCCCTTTAGCAATCTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGC
CGCCAGACGGTCTCTCGTAATAGCAACAAGTTGTCGGATGCTTTGAGAGAAAGCAAAGGCAACGGGACGGTGCGACTGGCCGACGGGAAGGTCGTCACTG
TCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTGTGACAGTCCAGAATGGTTTACTGTTCTCGACATGGATCCCTACGATATGATCCTGGG
CATGCCCTGGCTCGCGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGTCGCCCTGCGAAGGCTGACAGAGCATTGGTGAGTCAG
GTTCCCACCTCTGTCGGGACCCGGGGCGCCCGTAAGTACTCCCAGTGTACCGAAGCATCCAGCAGATGCTTGGAAGTCGTCGACGCATATGACGACTCCG
AGGACGCTTCGATGGTGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACATAGTTCTGCAGACAGCTTTAGCTGT
CACGAACGCTGGTGATAGCGTGTCCAAGGTGGGTAACAGCGCTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTAT
GTGGGTAAAACAGTGCCACACACGGTCATCCAGACCATAACTGAAGAGGAAGACGCGGGACGCGCTTCCTGTGTGGGTAACATAGTATCACACGAGGCCT
CGAGTGTCTCGGATGCCGGCACCTCGACATCCCCAGACGTGGGTAACGAAGTTTCACGTCACGGTCGCCGTCGACGATAACGCCGCCGGATCTGAACCTC
GTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGTCCCTGGCTCCTCCGACACGGCCGGTGGAAGAGTGTTATCACATCTTCCGGTTTACCCGTC
AAAGCATCTGGTGTCCATTTGGAACCGTTGGCAGATATTGCAGAGATACTGAACCTCGAGGGAATGACGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTG
GGAAGGTAGCCGAGATGGTGCTCATATGACCTGAGACCACTCGGGAGGAGCTAAACTCCTCCTCTGCCTTGGACGAGGACGTCCTGGAAGACCTGAACAA
GCAGCGTCAGACGCGCTTGGGCTCCGAGATCCTTAAGAGCCCCAAGGATCCGGTGTATCCTTTGGTGGCGGAGTATGCGGACGTGGTGAACAAACACCCA
CCGACCCAACTCCCACCAGATCGAGGTGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAAC
AGTGCGAGGTCATCGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACACCAACTTTCTGCGTTCGGAA
GCCGATCGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGATGCCGGCCCAGACACCAATCCCACGAAAGGATGTGCTGTTGAAC
AACATGGAAGCGTACTGTACAGTGCGCCGGATTTGGTAGACGGATACTACCAGATCCTGATGCGTGAGAGCGATATCTCACTCATCGCGGTGAGCACTCC
AAGCGGCATGCTTTGGGAGTGGATCATCATGACGCAGGACCTGTCTAACACCCCAGCGACATTCAACCGCCTGGTGACGCAACTGTTCAGGCTATTACGT
GTCTTCGTAAAAAACGTACTTTCGACGCACATCATCGTGCCGAGGAAAGCCAGACGCGCCCATGGAGGTGCATTCTAGGACACCTCCGTCGAGTGTTGGG
ACGCTAATGTCGAGCGAACAAGCTCTACGCCAACATCAACAGGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGCTTGCTTCGTAAGCAACGTGGGC
GTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTC
ACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCAACCTCCTTCAGAAGAACGTCGACTGGCGCTGAGAGCAAGAGCACCAGGATGCTTTT
GACAGCATAAAGGCCAGTCTCCAAGCGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCAATTACGCCATCG
GATGTGCATTGCTGCAGGCCGGCACGGTTGGACACGAACGAGTCAGCTCGTTCCAGTCCAGGCAGCCCAAAGCCGCCGAGCGGAACTACCCTGTCCACGA
CAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGG
ACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCA
ACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGACTTGGCCCACATCACGCGGGTGACAACGGATCTATGTGATCGGATACGCATGGCGTATCG
GGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTCTGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTTGCGACAGCGCTCACGGCTCCACCGA
TATGAGTTGACTCTATTACCAGGTGGAGCCCAATGAACCCCCACGGGTTGTCGTACAACGACGAGGATGTGAAGTTTGACATCCCCGCGGAGGCGCCCGA
CTCACCCTCCAGTGGCCACTTGGGTCGCGAGAAGACCTTCTTGTCGGTCTCTCAGGTCTTCTGGTGGACCCACATGTACAAGTGGGTCGCACGATACGTG
AAGACATGTGAAACATGTCAGCGGGGCAAACCCGCAGGTCACGCTTCGGCTCCACTACAGAGCCTGCCGTACAGGCTGACTGTTGGAAGTCGATGAGTCT
TGACTTCATCTTTAGGCTTTCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAACATGGTACATCCCCCTCCAGTACCC
GTTACCGTCACAGGCGAACAAACCGCGAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACTGAGACCCGCGGT
TCACGGTCGCGTTTTGGAAAATGCTGTTCCCTTTACTAGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCACAGACACACTGCCAGACGGAGCGCGT
TAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGAAGCACCACGTACGTGGTAGACGCAGCTTCCAGTAGTTGGGTTTGCGCTCAACAACG