Description :
From Genome Similarity Track
Location :
Scaffold_1:5484735- 5501097
Transcript NameFunction/comments
Physo_323472AlNc14C22G2296
Physo_310702phospholipid-transporting ATPase, putative
Physo_472437GTPase
Physo_476753ser/thr protein kinase
Physo_35514660S ribosomal protein L6, putative
Physo_350716copper-transporting ATPase, putative

Sequence
16362 bases(100 bases per row)
TACTCAGTCAGCACAAAAAGATGCTGGTTTCATCGTCGACCTGAATTTCGTGGCACTTCAGGTCCACCAGCTGAGCTGGCAGCTTCTCGTCTGCCCCGTC
GATCCGAACCATCTCGACTGGTGCGTAGAATGCAGTAGCTGCCGTGTACGGTGGTCCCCACAGCTCACAGTGAGTTCCCTTGAGTTGGGGGCTCGGGTCC
CAGTAAATTTTGCCTTCCGAAGGAGAAGCACCGTACCGGCCAAGCTGTTTCAGCGACTCATCGTACCACTCATTTTTCTCCGGCAGCTTCATTCCCAAAG
GAGAGAAGAAAACATGAACAGGCCGTGTTTTCGCGGAGTTGCCGGGTGGCGGTTTGCAGTTGTCGCCATTGGTAAATAGAGGAACTTCAGGCGACACAGC
CTGATCGTTTTCCCAACACGCCGATGGGGGAGATACCAAGTGTTCCTGGAGACTTCTTGGCACAGGTCTTTTGTGAGCGTAAACGCTTGACTCTGTAACA
CCAAGGCACTCCTCCTGGCTTGCACTGAAGCCCCACTGCACTTGAGAGTTGCTAGGCGAAAACAGCAATCTTGGGTCTGTGAAGATTTCATAGTTGAACC
GCACGTGTTTTCGTTGACTTTTGTCGGCAAGCTCTCTCGAAGATTCCGCTGGCGTAGCTGCGATTGCCGTTGTGAGAATCAAATTGCAGGCCACCAGCAC
AGTCACTGCATCATACACTCGGCGCTGCACGTCATTATACGGAGGTTCATTCCGCGGCGATGTCGAAGCCAAGGCGCCAATGCTTTTCTTGGCTTTGACA
AGCCTCTCGCTCATTCCAGGTACCGCCATCTCGACTTGATAATCTTGTAGAAACAGCAAACTCAGGAAGCAAACCGTCGTAGACGCCAAGCTCGTCCACT
TCTCTGCTGCTGCCTTCTCTTCGATTGCTTGCACCAGAGCACTATCTTGCTCCGCAATGCTGGATGCCTTCAAGCCACGACGCTGGCGAAAATTCACCAT
TACTTGTGCCGCGTTGCTCTGCATCTCCGCCAACCGTTGAATCACTGCATCCTTTCCAAAGTATAGGAAGCCGCCCTTGGTCCTCCGGGTCTCGACGCAG
CGAACTCGCTTGATCACTCCAATCCCTATGGGTGCATCAGCACTTGTCGTATCTACACTCTCCCCCATCAAAAATATCAAACCCAGATCGGCATACCTTC
CAGCACGTTAAGCACGTCGTAGATCCTCCTCTTCTTCGGCACTACGTAGCGCTCATCAGGACAACAACTCCACCACAAAACGAGAGGGATGCAAAAGTAC
ACACGCTACCCTTCATCTTGTAGATCTCACTGGCCCGAACGAAGATGGGAAACTCAGGAACAGATCCAGCATCCTGAAGGTCTTCGTGCTTCTCAAAGAA
TTGCAGCATGATCTGCGTACTGCGGAACCACAACAAGATCCATGTCGGTCCGCAGCCGTTGTCACTCACTGCCCACGACGTCTGTACTCACAGTTCCCCC
AGATTCCTGGCTCCTGCGAGCTGCTCTTGGACGTCGCTCCAGGTCGCACTTGGAAGATCATGAGCCTGTTGCGTTGCGTTGCTGTGGCGCGCCTTCACTG
GGCTGACGCGACGCGAGCGCTGCTGGCGCGTTCGCCGCTTCACCGGCTGCTTGGGCACAAGCTCCGTCCTGGCGGTCGCTGCAGGAGCGCCGACTTTGGC
GGAGTTATAGCGTAGTCTGCGTCTGTGGGTCTTCATCGACTTGCTCCCGAGCCGGCAAATTCGAAAGTGAGCGGATATGTTGCAGTTGAAGAGACCATCA
CTCTGAGAAGGCTATTCAACCAGCACGAACGTGATAGAGTAAAGGTAGTTTGCATATCAGACGAAACTATTTGTTTCGTTGGGTAAAAAGTGGTGATGGT
CGCTTAGCTGTTTGGTTTGACAAGCAAAAGCGAAAGGGCGCACAACATTTTTGCTGTTGACGCTGTTGCAGTCTTACATAAACCTGATCGAGTACATGTA
TTAATATGACTCGACGTGTGTAGAAGCAACCAAAGCTGGCACTCTTTGCGGCACAGATGCATTCTCACAGGGGGGGAATTTGTCGTTTTCGTTTCTCCTT
CTAGCTCCCACTCAATCAACGAGTGCCCAGCGTAAAAATACCCAAAGCTTCAGAACACTTTCGGCACTTTGCTTTGCATATAAATAGCGAGCTCCGTCTT
GTGTGCTGGGCGGCCCAGCCACTGAAGCAAAACCCCTTCCTCATCTCACATGACCGTCCTCTGTGCTCTATTCGCAGCGGTCGTCGTTAGTGCGCATCGT
TCCTGTCTCCTCGCTTCACCTCTGGCCAACTCGCATCGGCTCCCTCTCTCTGCTGTCGCTGACCCATGGGTGAAGGAACAGCGGGAGGCGCTGGAGATTT
CCGCGTCGTACACCTGAACGATGCCAGTCGCAACACCGAAGCCGGCTTCTGCAACAACTTCATCGTCACTTCCAAGTACACAGTGGCGAACTTCCTGCCC
AAGTTCCTCTTCGAGAGTTTCCGCAAACTCTCGAACCTCTACTTCCTCATGATCTGTATCCTGCAGTGCATCCCCGAGATCAGCAACACCAGTGGGCAGC
CCTCAACTTTGCCACCGCTGCTGTTCATTATAACGGTTGATGGCGTATTTGCTGTCCTCGAAGACCACAAGCGCCACCAAGCGGACAACGTCGCCAACGC
AAGCCCCACTCTCGTCCTCGACCGTGAAACCCGGAAATTCAAGGAAATTACATGGGCAGACGTTGTGGTGGGAGATATCGTCAAAGTTGGAAACCGTGGG
CTGGTACCCGCTGACATGTTGGTGCTCGCGGTTAGTGAAGTTGCACGGTGCGGAATCTGCTATGTCGAAACCAAGTCATTGGATGGAGAAACCAACATGA
AAGTCCGATCGGCGATGGAGTGCACGTTGGCAACGATGGGTTCTGTCGACAATCTTGTCGCGATGAAAGGTGTAATCCGTTGCGAGCACCCCAACAACGC
CATCAACAGCTTCCAAGGTGTGCTGGAGCTTGAGGGGAAGGAAAAGGCGTCGATTCCGTACGAAAGCATCATCCTTCGTGGTTGCATTATCCGCAACACT
GACTGGGTGCATGGTGTGGTTTTCAATACCGGCAAAGATACGAAGATTATGATGAGCAACTCGGCGCCGCCGTCTAAAATGAGTTCCATGGACCGATCTA
TCAACCAGTACACTGTCGTGCTGCTGGCGATTCTGATTATTTTCAGTGCTGTTGGAGCAACGGGTGCAGTGACCTGGAAGACGAACCACAGCTCTGTGTG
GTACCTTGAATTGGACGCGTCCGACAACAGTGCCTTTGTCGACTGGCTTATTATGTTGTTCTACTACCTGCTGCTGATGTACCAGTTCGTGCCGATTTCA
CTTGCGGTTTCCATGAGTATGGTCAAGTATCTCCAAGCGCAGTTTATCCAGTGGGATATCACAATTTACCACCCGGACACCGACACCCCGACGCTCGTGC
GCTCCATGTCTTTAAATGAAGAGCTTGGGCAAATTTCGTACATATTCTCTGACAAAACGGGCACGCTTACCTGCAACGTTATGGAGTTCCGGAAGTGCTC
GATTGGTGGCGTTTCGTACGGCAATGGTACCACTGAGATCGGCTTGGCAGCGTTAAGGCGTGCAGGAAAACCCCTCCCCGATATGACTGTGCAGTCAAAA
GACCCCAAGGTTCCTTACGTGAACTTTGATGGCCCAGACCTGTTCAACGACATGAAAGGGGACTCGGGGTCAGTTCAACAGGGACGCATCGATGCCTTCT
TCACCCACCTCGCGGTCTGCCACACTGTCATTCCAGAACGCCACGAAGGTTCCAACGAGGTTACACTGTCGGCTTCTTCACCTGATGAGCAGGCTCTAGT
TGCTGGTGCAGGATACTTTGGATACGAGTTTGTGAACCGATCTCCCGGAGTAGCGCACGTTAAAGTCCGCGGTACCGTACAGAAATACGAGATGCTAGAC
GTGCTGGAGTTCAACAGTACCCGCAAGCGCATGAGCACAATTATTCGTCACCCCAACGGCCGGATCTTCTTGTATTCGAAAGGCGCAGATGTGATCATCT
ATGGGCTGCTCAAGAAAGACAAAGAGGACGAATCAACTTCATCTCAACTCCAAGAGATCACTCGACGCCACATTGACCAATACGCAGAAGATGGACTCCG
CACGCTTACAATCGCTGTTCGTGAAATTGAACCGTCCTACTACAAGGAGTGGGCGTCCCGTTTCCACGAAGCCCAGAACAGCCTAGCTGAAATTGACAAG
CGCAAGAAGGACCTACCAAACGACATCGATGAATGCATGAGTGAGATTGAGAGTGACTTGGAGCTGCTTGGAGCTACTGCGATTGAGGATAAACTGCAGT
CTGGAGTCCCGGATACGATTGCCAATTTGGCCTGCGCGGGTATCAAGATCTGGGTTCTCACGGGTGACAAGGAAGAAACGGCAATCAATATTGGCTTCGC
TTGCCAGCTCGTGACAAATGACATGAAGCTTTTCATCATCAATTCGAAGAACGCACCCACGCCCGATATCCTTGAAAGCACTTTGCGGGATGAGATTGGG
GCGCGCAGCGCGGACGTCACTGTGTATCTCGCTTCGCCTCCGAGCACCAGAGGAGAGTTACGCGAGCTGGCTTTAGTCATCGATGGCGAAACACTCATGT
TCGCACTACGGGGACCGTGCCGTCCACTTCTCGCTGAATTTTCTCAGTACTGCAAGGCCGTGATCGCTTGCCGTGTGTCTCCTGCTCAGAAAGCTGAGAT
GGTCGCTCTCATCAAAGAATATGTCCCTGGTGTCCGCACACTTGCAATTGGAGATGGAGCAAACGATGTTTCCATGATCCAGGAAGCTCACGTGGGTGTT
GGTATTTCTGGCCAGGAAGGCATGCAAGCAGTCAACTCGAGTGACTACGCTATCGCCCAGTTTCGCTTTTTGCAGCGCTTGTTGCTCGTGCATGGTCGCT
GGAACTACCGGCGTATGGCGCAGTTGGTGCTGTATATTTTCTACAAGAACATTCTCTTTACTGCGGCCCAATACTGGTTCACGTTGCTGTGCGGGTTTTC
GGGGCAGAAGTTTTACTTGGAGAGCGGTACACAGCTGTACAACATTGCTTTAACGGCAATTCCTATCGTTGCAGCTTCAATTCTGGACCAAGATGTGAAC
GACGAAGTGGCCATGACATTCCCCAAGCTCTATTTCACGGGACCTCGCGACGAAGATATCAACACCAAAATTTTCTCTCTTTGGGTTGTCGGTGCGATCG
TGGAGAGCCTTATCATCACCTTTGTCACTCTTCACGGGATGGCCAACGCGGGGTTTCATGGAACGAGTCCGACGATGTGGCTTGAGGGCTACGTCGTGTT
TACCCTTGTCGTGTCGATTGCCAACTCGAAGCTGTTCATGTTTCAGAACAGCTTCTATTTCTTCAACTACTTCCTCTACGCAGGTTCTGTGGGTGTGTGG
CTCATAGTTGCGTTGGTATGCAGCCACGTCACAATCCTCTCCGACCTCACGTGGGAGCTCATGCTAGAACAGGCTTTCGAACAAGCGTCGTTTTGGCTGG
TTTGGCTCTTCGTGCCAATAGCAGCGCTCTCATACGCGCATCTCCTCAACGGCATCAGATCGACGTTCTTCCCTGAATATTGGCACCTGGCCAAGGAGGT
GATCAAGTTCAACCTCGATCGCAAGCTCTTGCAGTGGAACGATAATAGCAACTCTTCAGTGGCCGTGCCAGCTCGACTACCTCGCTCAAAGGCAACCAGG
AAGAACGGATCTGTCATTCCAACTAATGGTCGACCTTCGCAGCACCGGACGACGCTACAGAAGGCATATCACGGGTTTGCATTCTCCAAAGATGGCCACG
CCGGGGCCACAGAAACTCGGTTACTCATGAGTCGTGGCTCTGTCACTAGTGGGTGAGTGTGAGGCGAATGTAGTCGAACTTACATTAAAACATACACTTA
TCGATACCGTCCAGCGTTTCCAATTAGTTGTGATCACTCGACAGAAGTCTTGACGGCGGAAGAGGTACAACATTACGCCTTTCAGCATACCCTATCTGAG
ACTGGATTCCTGCACGTGGCGGTGAAAAGAGCAGCAACTGATCGATCACTCGCTGCTTTCCTTCGAATACGGTCGGCGCGTCCGGCTGAAAGTCTACCGC
TCGATTTTGATACAGCCTAAAACGCAACAAGTCGTGTTCAGGACACGCACAGCACCTATACACCGGCAAGGTTACACTACCTGGCCGCGATGTGCTCCAG
TCTCATGCAACGATGCAATGCTGGCATGCTTCCCTCCTGCACTCTCACGTGCTGTCTTCTAAACCTTCGGTATCTTTGAAGGAAATCATGGTTGCTCCTC
CCAGTTGAGTCGTAGAGCTGGAAGGCCAGGCGCTGCGGGCTGCAACGACTCCACCGAGCCAGCCCACGAAGGTTCCTAGCAAGACGCAGCCGCCTCACTG
TCCTAATGACTTTCGCGTCGTGCTCCTGCTGTTCCTTTTTCCGCGTTTCTTCCAGTCGCGCAGCTTCCAGCGCCTTGGCTGCGACTGCTGCATCTTCCAC
AGGAGGCGCGGCACGAGCTGCAGCCCCTCGCTTGACGCCGCGCTTCTTCTTCTTGGGCGTGCGGCGCACTACCAACCGCTCGTACCTGTTGCAACCACCA
GCGTGCAACAACGACATTGTGAGCTACCTGTCGCTAACGGTAGTCACCACACACATAAACAGCATTCCTACAAGCGGTTGAAGTCGTCCGCATCCTTGCT
GGCCATTTCGCTCTTTTGGTTCAAAATAAATTACGGTACCGTATTCCTTATGTGCTTCCTGACAGCCATCTTCGCTACAACGCCACAAAAAAATCGATTG
TGAGCTTATCTTCAGTGAAATGATTGGCTCACTTGAACAAATAGCGTACTTTGATTGGATACCTAGAAGTATCTGGAAACTGTCAGTAATTAAAATTAGT
CAGCAAGCACATACGGACTACGGTAAGTTATTTTCGCAGCGGTATTGGTGAGCCAATCGAACAGCCACACAGATCAAGCAAGATGCTGCGCGTGTCCAAC
CTGCTGCGCGGGCTCACGGCGGCGCCGCTGCGTCGCGGCAGCGTCTTAGGGCGCTCCTCTGTGCGTGCCTTCAGCGTGCAAGGTGGCGGTGGCGACGACG
ACGACGACGACGACGACGACGATCTGGAAGACATGGAGCTGGACTGGGACGACATTGACGACATCGACGAGGACTGGGAGCTGGACGACGAGGGCGACGT
GGCCTCCGCCGGCCGCCGCAAGATCGAGGAGCACGTCAAGCAGAAGGTTCGAGTGCGGCGCGCGCAGCACTCGAAGCGCCGCTTCGTGGACCGCATCCGC
GTTAAGGCCACCGGTGGCCACGGCGGCAACGGTTGCGCCAGCTTCTTCGCCGAGTCGGCGATGCGCAAGCGGCCCAATGGCGGTCACGGCGGCGCCGGAG
GAGACGTGGTCATTGAGGCCAGCGACAAGATGCAGAACTTGGCGAACGCGACGCACCACTTCAAGGGAGGAGCAGGAACCAACGGAATGCGTGAGTGTTG
GAGCGCTTGATTGCAGGATTGTTGCTGATTGTTGCTGACTGAGGTGGATATGTTTAACTGCGATGCTGTAGCGAACGATGCTGCTGGAAGGAGAGGCAAG
CACTGTGTGGTCAAGGTCCCGTGTGGTACGCTTGTGAAGCGGGTGGAGCGCTACGAGCGCGAGCTCGAGAACGGCGAGTACGAGATTGTCGACCAGATGG
AGACTGTGTGTGATCTGGACAAACCTGGTGCGACGTTCCTTGCTGCCAAGGGTGGCAAACCTGGTCTGGGCAATCGCATTCTGGCCGGCAAGACTACCAA
GTTCGGTCGGCTGCGCAAGCACATGCCGGAGAACAAGACTACGGGTCACCCGGGCACCTCGCAGTACTACGAGCTGGAACTCAAGACTATCGCTGATGTG
GGTCTCGTGGGCTACCCGAACGCTGGCAAGTCTACGTTGCTCAGCGTGTTAAGCCGTGCCACACCCGAAATCGCACCTTACCCGTTCACGACACTTCACC
CGTATGTGGGTATTGTCGAGTTCCCGGACACGTTCCGCTTGAGTGTCGCTGACATCCCCGGACTGATCGACGGGGCTCATCGCAATGTTGGTCTGGGTCA
TGATTTCTTGCGCCACATTGAGCGCACAAAGGTGCGCACGGAGAAGGTTGGGTTTCGTATAATTGGTCAACACTAAAGTGTGGTGTGATGATTCTTTGTA
TATAGATCCTGATGTATGTGCTCGATACGGCGGGCTCAGAGGGGCGCGACCCCCTGGAGGACTTTACACACCTCCAGCGAGAACTGGAGCTTTATGCACC
AGGGATTTCGTCGCGGCCATCCTTGATCGTTGCCAACAAGATGGACGAGCAAGGTAAGAGCTGACACCCAGTGCCCGAGTACAGAGGGGAACAGGTGGGT
CTGACCCTTTGCAAATAATTGCAGGTGCTGAGGACAACTTCCACAAGCTGCGCCAATCTACTGACTTAGCTGTCCTTCCAGTCAGGTAAGCTCTGCATTT
ATACCAAAGTCAGGCGCCTACAGTTGCAGCTCTCTAACCCATTTTGTTGTGAACAGTGCTCTGCACAAGGTCGATATCGATACGGTAGCGCGTACCCTGC
GCTGGATGATCGAAAGTTACGGCAAGCTCACCAAATGATCATAGAAGTCTTGCTAATTGACTCGTCAGATATCAGCAATACGAACGGACCCTGCACCTTT
AACGAACGCCGCCCCTTGTTGTATTTTTTGCCGATGGTTATTTATACGTGCAGTCTAACAACCTGCAGTCTTATTTCTCACTTCCACAGAAGCCAAGGAA
TTCTGTGACTCTAGCGGAAACTACACGATGAATCGTTATGAGATGCTAGACCGGGTTGGCGACGGTGCTTTCGGTGAGGTTTCCCGTGCGCGTAGCCTCA
AGACGCACGAGATCGTTGCAGTCAAGAAAATCAAGGCGCTGTTCCCCACGTGGGAGGAGTGTCTCCAATTGCGCGAGCTCAAGTCGCTGCGGGTGCTACG
TCACGAAAACATTGTGCTACTGAAAGAGGTCATCCGTGACAAAGAAGAGCTCTACTTCGTGTTCGAGTTCATGCAGACATCCCTTTTCCGAGTCATGCGT
AACTTTAAATGTCAAGGAGGAAGCAGCAGCCCAGTGGTTGAAACAACTTCAAGCTCTGAGCCGTCGACGCCGTCGTGGACTTCAACGCCTCCACATCCAT
GGTTTTCGGAGGCTCAGGTGCGGTCAATCATGTACCAACTCTTCAGTGGGCTAGCCTACATGCACAAGCACGGCTACTTCCACCGCGACATCAAGCCCGA
GAACCTCCTGTGCCATGATGACACACTGAAGATCGCTGACCTTGGACAAGCTCGAGAAATTCGATCGCGACCACCGTTCACGGATTACGTTGCAACGCGA
TGGTACCGGGCACCAGAACTCTTGCTGCGGTCTACGACGTACAACAGCCCAATTGATATGTGGGCGTGCGGGTGCATCATGGTTGAGCTGCTCATCTGTA
CTCCACTGTTTCCAGGGACGTCCGAAGCTGACCAATTCTATCGCATTTGCAAGGTGCTCGGCACACCAACCAAAGAAACCTGGCCTGAGGGTGCAGCAAT
GGCTTCTCACATGCAGGTGCGGTTTCCCAAGTGCGCTCCGGTCTCGTGGGGGCGATTCTTACCTCCAGGTACACCGTCTTCAGCCGTCCAACTTGTGCAA
GACCTACTCCAATACGACCCAAGCCGACGCATAACGGCAGCACAGGCACTTCAGCACCGCTTCTTCGATCAGACCGTGCCGCGACCAATTTTAACGATAC
CCTCACTTGCTATGGTCGACGAAGGAGTTCCTGTGTTGCCACTCCGAAGTGAGTTCAAATCTGTTGGGGGCTTTTCAAGTTACGCAGGTCGAACAAGCGT
CTGTGCGAAGGAAACAAGTGCAGTGGAAAATTCGGGTCATTGGGCTGGAGGTGGCGGGCTGTCATCGCGACAAGAGCATCATCTGTGGACGGCTAAAGAG
CGACACCAAACGCACGCGCGACACCAAGAATGGGTCTCCTCACTCATTGGCAGTGCTCGTCCTGGCGGGTTTGACGACGTGGCAGAAGCAAAAGTTTGTG
CGTCAATTCAAAGCGGCGGCTCGTTCAAAGGGAACTTGATAAAGAATAGCTCGAGCTACAGCACCCTTGCTAACGAAGGCAACAGCGATGGTCTGAACTC
AACTCGAAAATGTGCAACGACGTCGGAGGACGAGAGTGATGAGGACGCTAAGAACGATAGCACTCTGTTACAAGACCTGCTAGATGAGATTCTGGGATAA
AGAAGAATTGGAGTTTGGTGATAGTTTCATCAGGTATATTGTTCTTTCATCTCATTCCATCGCATCACACTGCTAGAAAGGATAGCAATTGCGCACTTAG
AACTTGAGGGCGTGGGCGCGGTCGTTCTTGGTCAGCGAGAACTTGGCGTTCAGGTAGGCCTTGAGGAACGGCTCAGCGTCGAGCTTCTTGATCAGAGCCG
AGTCCACGGCCTTCTGGTCCTTCTTGCGCTGCTCCGGGATGACGGGGGCCTGTGGAGGATACAGCAACAACGCGTTAGTATCTTATAGGGAGCTTATGTG
CCGAAGCAAGCGATCCCAAGCGCTCATGTGGTGTGGAGAAGAGCAAAGAAGCCAAGGCATCAATACCCTCCTCCAAATCCGCCCACGCAACCACACACTC
TCAAAAAGAAGACAAGGAGAGATCCCAAAGGTTCATCGATCCCAATCTTTCCTCGAAAAGCGCACAGTCACGTGGTGTGGACGAATCGTGTGAAGTGTTC
TTGACGAACCGACCAACGGAACGGGATGCTCACAAGAGATCGCAGGGAAAATGATGAAAACTTACGGCGCTCGACTGGGCGAAGAACTGCTCCTCCTTGC
TCTTCTTGGCGGCCTTCTCCTTGGCGAAGTAGGCGTCGTCGATGGCAGGGAGCTCCAGGCCCTCAATGTTGACCTTGGTCGACGTGGCGATCACGTACGA
CTGGTTCACGCGACGGAGCGGCACGCCGTTGACCTTGTACGGGCCTGTTAGAAAGACACATCGCTTGGTTAGAAGCTGATCTTCAAGTACCAGCTTACTT
GTTGAAGTAAACTGGATCCGGCATTCCTCAGGTCTCATAATCTGATGGATCTTTGGCAAAAAGACACCCCTCCACATGTACCAGGACAGCCATCGGGAAC
CGCATGCCACTAGCCATGTGCCACTCAGAGCAGTCCTCTTACGAGGCGACAATAAGGGTTATTAGCGTAGTGACACGAGACCATGGGAGCCGAGGCAGAT
ACGGAGGGGACGGCAGAGCGCCTCTCAAGTGTCAAGTTTGCATCATCGGAATGCCGTCTCCAATGCCTCCACCATTTCACAAAAGAATCTTGGAACTGAA
ACTTACCAGTCACGAGCAGCAGGCCCGAAGCCAGCTGCTTGAGGAAGACCACGCGCTTGCCACGGAAGCGGCCCGACAGCAGGATCAGGACCGTGCCGGG
GGTGATCGACTTGCGGAGCTTGGCGGTCTTGACGCTGTTGCGCTGGGTCTTGGCCGAAGGCAGCGGCTTCGGGATGTAGTCGGCCGGGTACCACTTCTTG
GTGGACACCTTCTTGGCGACGACCTTCTTCTCGCCGCCCTTCTTGACGACCTTGCCACGGCCGTTCTTCTTCGAGAGGCTGTTGGCCGAGATGGCGTTGA
TACCGCGGGCGAGCACGATGTTCTGGGTCTTGGCGGGCATGGTGATGAATATACCTGAATGAAGGAGCGAGAGGCGTTAGGGGGACAACAGTCCACAAAG
AGACGATGCCATGACGCTGGTCTCTTACCTGTCTGAAAAGAACTGAGCCAAAGGAGGCGCTCTCGGCGCAGCGAGAGGCAACCACAGCCAACCACAACGG
TTGATGTGTCGAACACAACTAAGAGCGGTACCGTGTACCCTCTGGACACGCCCAGCGGTTAAGAGGCCGGTTAGGGTTAGGCCTAGCGGGGTACCGTGAA
AGATACCGGTATTGCCGGTAGTGCTAGCCCTGCTGTCATCAGGCTTGCCCTGTCATGCTAGGTTAGATGGCTCGGTGCGTCGAAGCAGGTAAGAACATCG
TGGTGAAGTACATTGGAGCTAGCCCTCTCGTGCAGTACTTACAGTTAGCGCTTGGCTCGCTCGCTCCCCCTGTGCTTGGATGTTCATGCAATCACTGTCA
TCAACCCCGCCAAAGCTGATCACCTTCAAGCAACTTCAGTAACTTATGTTGCCCAGCGACGTAACATGAACCACCGCTTCAACACAGTGCAGATCTCATC
CTGGCCTTGCAGTGCGGTGCTGGCCTGCTGCTTCGCTGCGGCAGACTTCATCACGCCTCCCAGCGAGAGAACGCCTTCCACCCACCGAGCACTACTGTAG
CCATCAAGCCATGGGCAAGCGCAAGGGTCGCCGTGCGGCCGCTCCCGCCGCTCTGGTGGACCCCATGGACCCCGAGACCTCTGAGCCGCCCTCGTGCGGG
GACGGGGGGGGCTGCTGCGGCATCAAGAGCGACGGGGGAGAAACGGCGGTTTCCTGCTCAAGCGGCGAGGAGGACGTGGCTGCATTGAAGAAGGAGGAGG
AGAGCGAGACGACGGAGGTGTGTGCGTCTTCGTGCTGCAGCGGCGACCAGAAGAGCGGGAAGGAGTTTTCGCCAGGGGCAGAAGGAGGCAGCTGCTGCGC
TGCTGAGGAGGAGCAAGCGGCCGCTGTTCAAGTAGATGTGAAAGCGGCGGAGGTTGCTGGCTGCTCGTCCGAGGCCGTTGTGGATGAGAACGGAGCTGAC
GACTGCTGCAAACCGAAGCAAGAGGGCACGTCTGGATGCTGCTCGTCTAAAGTGGAGGTAACTACTGCCGATGCGTCCGCTACTAGTTCAGGCTGCTGCT
CGTCGAAGGCAGCAAAGACTTCAAGTGAGTCAGACGAGTCCTGTGCGTCTAGAGGCGAACCGAAGTCGACTGCCTGCTGCTCGTCGAAGAAGAAGGAGGT
CGACCCGGGGTGCTCATCGTCCAACGCCCTGGAGGCTGATCTTGCCGCTGACGACTGCTGTGCATCAACGAAAAAGCCCAAAGCCTCTGGTTGCTTCTCG
TCAAAGGCGAACAAGACTCCTGGTGTGACTGCTTGCGGGCCGTCGGACGTGCCGATGGCCAAGGGCGGAGGTTGCTGCTCGTCCAAGAAAGAGATCAAGG
AATCTGGATGTGGTTCGTCCGACGCGTCAAAGACTGAGTGGAGTGGCTGTTGCTCTTCCAAGAGAGAAACGAAAGCGTCGGGATGCTGCTCATCTAAGGC
GTCGAAGAAGGAGTCAGGTGGCTGCTGCTCATCCCCAAAGGGCAAGAGGAAGACGCCTGGTTCGGGATGCTGTTCATCAAAGGCGAAAGACCTGCCGCTT
CCGGAACGAACCCCAAGCTTTTTAAACCGCTTGGTGCAGTTTCGCAGCGACCGCGGCGCTGCGCTTGAGAAACAGCGATCGAACTTCAGCAGCTCGGGTA
AGCAGAGAAAAATGAGCGAATCACTGGAGACGCTGCGCCTGAATATTGGCGGCATGACGTGCAGTGGCTGTTGTACGCGGATCGAGAAGTTTATGGTCGC
GCAGCGTGGTATTGCAGACGTGAATGTGAGTCTCCTTACGAGCCGTGGGGTCTTTCAGTATGATCCGCGACTGGTGACGGCAAAGGACATCGAGCAAACC
GTGGCTACGCTAGGGTTTGAGCCGAGTGTTCTGTCTAGCGACGAGCTTGTTAGCATCGTCCTGCACCTTGGACGGCCCGAGAGTGCACCGCGTGCGAGGA
AACTGCTTCTCGAGTTTGTTGGAGTTGCTTCTGTGGAAGACGCCGATGAACCGCCCATTTCTTCGGGCTCGGGCTTGTCGTGCAAGACGTTGCTTGTCGA
GTACAACCCGGATATCACTGGTGCCCGTAGAATTGTGCGTCATCTCTCGCGTGAGCTAGGATTCACTGTTCAAGCCTCAAGCCCACGAGCGCCATCGGTT
CGTGCAGGAGAAGAAGAAGTGCGTCGATTTACACGGCTGTTACTTTGGAGCTGTCTGCTGTCATTGCCGGTCATCTTCATCGAGTTTGTGCTGCCGGCAA
TTTTCCCCTCGTCCGACAACAACCCAGCGGATGCGGCAGTCTGGGGCACCGCGGGCCACTTGAGTGTCCGAGACGCTGTGGAGTTGGTATGCGCTACACC
AGTACTGTTTCTAGTAGCGCGCCCCATTCACGAAAGCGCTTTCCTGGCGCTGCGCTATGGTGGGCGGGTTACCATGGACGTCCTTGTCTCGCTAAGTGCT
TGCACGGCCTACACGTTTTCGGTTTTCACGGTTGTGACAAAGGCGCTCAGGAGGTCTGGAGCACCGGGAGAAGTCGGACCAGCTACTGTGGGCCCGTCAA
CAGGATTGACCCAGCAACCACCGCAGGGGCACGTGGAGGCATCATTGAGAGCTGATACGTTTTTCCAGGTCACGGTGCTGCTTATTACTCTCATCCTGGT
TGGTCGCTACATTGAAACGCGGGTGAAGTCTCGAGCTTCGAACAGTGTGGACGCGCTGCTGCGTATGCAGGCCAAGACTGCTATTTTGCTCGAAGACGAG
GACCAGAAGGAACTGTACGTTGATGTGGTGCTTGTCGAGCGTGGAGATCTACTTAAGGTTCTTCCTGGTACACGGGTACCTACGGATGGTGTGGTTGTGG
GAGGTGTTAGCTCTGTGGATGAGTCCATGGTGACAGGCGAAGCTCGTAAGGTGCCCAAGGAACCTGGAGCGACAGTGATCGGCGGCTCCATCAATGCTCA
AGGCGTTCTGACCATGCGGGTCACGCACACACTTCACGAATCCATGTTGGCGCGAATGGTGCGACTCGTTGGGGAAGCACAGGCCTCACGGGGTGTGCGC
CAGAGTATTGCCGATGCGGTGGCAGCATACTTCACCACGTTCATCATCGTTTTGGCGGTCTGCATATTCGCGTTGTGGTACTCTCTCGCTAAGCGCGGTC
TAGTGGACACACAGGGCTGGGGGCCTTTCCCATTTGCACTGCGATTTGCGATCACGGTCTTGGTCATTAGTTGCCCGTGTGCGATCAGCCTTGCTGTGCC
AACTGCTGTTATGGTTGCTACGACGAAAGGGTCGCAGGTGGGCGTCCTTTTCAAGGGTGGTCGGGCGCTGGAGGCGCTTGAAGAAGTGGATGCTGTCGTG
TTTGACAAGACGGGCACCCTCACCACTGCACAGCTCGGAGTGGCTAATGTGTTCACGCCAAGAAATGGTCTCAGTTCCACTCGGCTCTGGCGCTATGTAG
CCTCCGCGGAAAGCGGTAGTGAGCACTCCATTGGCAAAGCACTAGTCGCGCATGCCGAGACTCAAATCCAAGGGTTTCAAGTCGATGAAGCACAAGGGTT
CGAGGCCGTTCCTGGATGTGGGGTACACTGTACTGTGCGAAGAGTTGATGTACGCCTCGGTTCGCTCACGTGGCTTAAACAGCAAACGTACAGTGACTAT
CGTGCTCTTCGAGTTCCTCCGGAGTTCATCGAAGCAAATCAGCAGTTTCAGTCCCAGGGCTGCATCGTGGTGTTCGTCGTCGTTGATGGAGAACTACAAT
CTGCTATTGCGTTGCGTGACGCTCCGCGCCCCGAAGCCGCTCGTGTCATCGAGTATCTGAAGCACGAGGGAATCCAGCCGTGGATTGTCACTGGTGATCA
GCATGGCACAGCAATGAGCGTGGCAAAGACGCTAGGTGTTCCCGAAGGCTCCGTGCTAGCCGAAAGTCTTCCTCATCAAAAGGTCGACAAGGTGCGCCTA
CTGCAGAGTTTGGGCTTGCGCGTTGCCTTTGTGGGTGACGGTGTGAACGACGCCCCTGCGCTTGCTACGGCTGATGTGGGTGTGGCACTTGGAGCTGGCA
CGGATGTGGCTCTTGACGCTGCTGACGTGGTGCTGGTCAAGGACGACCTGCGGGATCTGTTGAACGCCCGTGCGCTTTCATGCGCAACCAACAGGCGCAT
CAGGCACAACTTTGCCTGGGGGTTCATGTACAACGTGCTGATGATGCCTGTGGCGTGTGGCGCACTGTATGCACCGCTCGGAATCTGGATCCCTCCGGCC
CTTGCTGGTCTGTCGGAGCTGCTCTCATCGGTACCGGTCATCCTCTTCTCGTTGCTGCTTAACCTTTGGAAGCCACCTTTCAATGGTGACTGGGGTCTAC
GACAGAATCATGTGGCGATCGACGTATCGGAATCTACGCCGCTGTTGCACAAGAAAGACTAG