Description :
From Genome Similarity Track
Location :
scaffold_102:54817- 56172
Transcript NameFunction/comments
g3616.t1hypothetical protein

Sequence
1355 bases(100 bases per row)
GGGCGTGGACGACCTGGTGCTGCTGCCGTCTGTGAGCGAAAACTCCATCCTGGAGAACCTCAAGATGCGCCACGCCGCTGACGTCATCTACTCGTACATC
GGCCACGTCTTGGTGGTCGTAAACCCTTATAAATGGCTCGATATCTACGGCGAAGACAGCATGCGTGCGTACATGCACAAGGCACGCATCGACGTGGCTC
CGCACGTGTTCGCCACGGCTGAGGAGACGTACCGGACGATGCTCAGTGAAGAGGACAATCAGTGCGTCATTATCAGCGGAGAGAGTGGCGCCGGCAAGAC
TGAGGCGTCGAAACAGATCCAGAACTACATTGCAGGCGTCAGTGGCAGCGGTGCGGGCGTCGACAAGGTGAAACGCACCTTTTTGGAGAGCAATCCGCTG
CTGGAGGCCTTTGGCAATGCCAAAACTCTTCGCAACAACAATTCCAGTCGCTTCGGCAAGTATTTCGAGCTGCTATTTGACTCTGCTGGACGACCGCAAG
GTGGTAAAGTGACTAATTACTTACTGGAGAAGTCACGCGTCGTTAAACCTGGCAAAGGAGAGCGCAACTTCCACATCTTCTATCAAGTGCTGGCTGGACT
GCCTGCTGCTGCTAAGCAGAAGCTGTACTTGGACCGAGGAGGGCCTGAGAGTTTTCACTACTTGAAGGCTAGTGGGTGCTACGATGTGGATGATGTGAAC
GACGCTCAGGAATTCGAGGAGACTATGGCGGCTATGCAACACGTGGGTATCAAGCGCAAACAGATCGAGCTGGTGATACAGACGCTGGCTGCTGTACTGC
ATATTGGCAACGTCCACTTCCAGCCTGAGACAGTGGGGGACGCAGAGGGTTCTTCAGTCCATGACCGCGAAAGCTTACAGATCGCGTGTGAACTGCTGGG
ACTTGATGCTGCGCGCCTGGAGCACGCTCTGTGTTACAAGCTGCTGCAGACGATGGCCCCTGGGGGCAAGATTGAGTCGTACGAGGTGCCTCAAAACACG
AGCCAGGCTAAGTCGCAACGAGACTCCATCGCAAAGGCCGTGTATGACCGACTGTTTGACTTCTTGGTGGAACGCGTGAACCATGCACTGGATATTGAAA
AGAAGGCCGAGAAACATGGAGAGATCCTGGAGATTGACGATATGACCACAATTGGCATCTTAGATATCTACGGGTTTGAAATCTTCGACAAGAACGGGTT
CGAGCAGTTCTGCATCAACTACGTGAACGAGAAGCTGCAGCAGATTTTCATTGAACTTACGCTGAAGAGCGAGCAGGAAGAGTACGCGCGCGAAGGGATT
GAATGGGCACCAATTCCGTTCTTCAATAACAAGGTTGTGTGCGATTTGATTGAAG