Description :
From Genome Similarity Track
Location :
Scaffold_81:54811- 56387
Transcript NameFunction/comments
g14496.t1hypothetical protein

Sequence
1576 bases(100 bases per row)
GTCGATAATGTTGCCCAGCGGCTTGGGCCCGCAGAAGAACACGCCAACCTCTTCACGCTCGTCACCACCATCACCAATCGGCTCCAGCCGACGATGGTTC
TGAGCCACCCGCGTGAGTTCGGCGTTCCAGTCGGGCCGACCGAAGTGCGTTCGCTGCTTGGTCTGCAGACCAGAGATGATGTCCTGCCCTTCGGTGGCGT
GGATGAAAGTCTGCAGAGCCTGCAACGGAGCGATCACCGCATTGCTCTTGACCGACGAGAAGAAGTTGTGAATCTCCAGGCGGTTCTCCGTGTCCATCTC
ACTGAGCTGGTTCATGGTGTTAGTGAACCACGTCAGTGACTCCTGCTCGCGCGTGACCCAGTAGAAGTAGATCTTACGCAGCTGGAAGTTGAGCGGGAAC
CGAACGTGTCTGCAGTGAGGACACCGATAGCTTTCCCACTGGTGCATGATACTGCGCAGAATCGACGCGAACGGAGTCACGCCGATGCCCGCGCCGATCA
AAACGACCTCCCGGTACCGGGTGTAGTCCTGCGCAGGGGCCCCCATGGGACCGTCCACGTTGATGATCGGGTATGGAGAAGTCATCGGACTTCCTTGGTC
CTCCACTCGCGAGGCTTCGTGCTGCGTCTGTAGCAGCTCCAAGTGGTTGTAGAGCGCGCCAGTCCAATCACCTGCTTTCTGGATGTGAAGGCTCAGGAAC
TTGTCTTCCGGCGCCGATGAGACGGTGAACGGATGCCACTCGAACTTGGAAATCGCAGGCACGTTCACAAACACATACATTCCCGGCAGGAAGCGCTGCC
TCCTGGAAAACGATTTCGGCTTCTTCATGAAAACCGCCACCGCCTCCTTCGAGAGCTGCACCTGCGCGATCTTGGTCTGGCCGCCGAACATCTGCGTCAT
CCGATAGCGTTTCTCGATCGCGTAAATGATCACAGGAGGCAGGACCCAGTACTGCGCCTGTGGGGCAGCCACCCAGCGAGCGAAGCCGTGGAACGCCATC
AACACCAGGAACGGGATCAGCAGCATGTGCGAAATCCAAAACAGGTTGAATTTCCCGCGGCGAACCTTCTCGAGGCACAGGGGAGCGGCGATCGCGGCGC
AAACGAGCATGACCACTCCAGTCCAGATCGGGAGGCGGAGAGCAAACAGGAACAAATTCTCATCGCGCACGAACGTCAAGTGGTGATACCGAGACGCCTG
CCAGACCGCCTCCGACACCGTGCGAACGTACAGCACAATAGCCAACCACGCCGCCGTGTGGCCGAGAGACGCAATCAGCAGCACCACGCCGCAGACCTTG
TGAAACTCGATGTGGTTGTCGATAGGGAGGTAGGTGACAACGGCCGGGAGTGATCGTAGCCCCGTCACGAAATTCCGGCACATGGGCAACAAGACGAACA
TGGTGTTCACGAGGCAGATCTCGGCAAAACCCTTTGCGATACGGGGACAGTTCCCCACGGCTGGGTCGACGGCGAACCGCGAAGCCTTGGCGATGAACAC
GCCAACCATCAGCACCCAGTACAGCGTGAGCCACAAAACCTCGGCCTTGTACTTGCGGCAGAACTTCTTCGTGCGG