Description :
From Genome Similarity Track
Location :
contig_50:548- 27529
Transcript NameFunction/comments
g8422.t1hypothetical protein
g8423.t1hypothetical protein
g8424.t1hypothetical protein

Sequence
26981 bases(100 bases per row)
ATCGTCCCGTACCCTGGTCTTCGCATCAAGTGTGAAAAATCGATGCAGTGGCTACGAACATTCGTATACGAAATGAAAGGGACTCACACACCACCCAACG
AGTGGTGTATGGCATTCGAACTGAGTCTTCGTGATGGCGCCCTTCATTGGTATCATCAACTGCCGTAGAAGACCAAACGTCAGTGGAATCTATTGAGCGA
AGCATTCATCAAGTACTATTGCTCGCAGTTCAACCAGTCGGCGAAATCACGGTACTACACTGCGAAGAGATCGGACAAGGAGCACATCTGCGACTACATG
AACTGTTTAAATGGTTATGCGCGCAACGCCGGAATCAAGTTTGAGCACGGTGGTCGTGAAGCAAAGGACCATGTAAAGCGTTTTCTCGAAACATGCGGAG
ACCGAGAACTCGAGAGGCGTCTATGCCACATGCAAGTGACTAACGTCCGGGTGTTGGAAGACATGGTAACAGACATTCTGAAGACGGACGACAAGAGTTC
CATTCGTGACAGCTCACAATATCCTTCTCGCGGTCGAGATTATGAACGTCGTCGCGATGATCGACGTAACGAGGACTCGGGGCTACGCCGGAATGAGCGT
CGAAATGATGACTCCCGAGAAGGGTATCAATGCCGCAAGAGGAGTGAGACCGACGCCGCGATGACTCGCGGCAGCGACCGAGAGTGACACTAATCGAAGC
ACTGAGCAACGCTATTGCAGAATATCAAGATTACGAAGTATCGTACCCCCGCAGCGAGGGCTCGCACTCACGCCCGCGCGAATATGATAACGACGACAAA
GACGACGAGGATTTTTGGCGGTCCGATGATAATGACCACTTCGACGATGACTACAGCGACAATTACGCATCGGGTGATGACGAACGTCACCTGGCAGCAG
TAAAAGAGAACGAACATCACGCTACAGTCGAAGGAAATCACCCGAAGCCCGACAATCGCCAGCCAAGGGGTGACTACACTGGCCGAGACTTCGGAAAGAA
CGGTCAACGCTTTGCCAAGGTAGCCGAGATAACCATGATGTTAGATCTCGCCCGTACGGCCCTTGTGCAGCTTGTGGTGGCCTTTCCCACTCCGCTCACT
ATTGCTACAAACGGTGCAAGCTGTGTAAGCAAGTTCACGATGCCGGAAAATGTGAAGCCTTTCAAGAGCTTACCAACCTGCTCAAGACCAAGGTTGACAA
GAAAGAGCTCAGTCCTGAGCTCCAAAACCTCGTATTCGGCAGCCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTTCCAATCGGGCTGCCAC
AGTTAGCCGAACCCGTGTTCACGGCAGATTGCATCTACGTAGTGCCGACTGCATCGTGTTTGATTTGCACACAAGCCCCGTCTCTATCGACAAAAGGGCG
AATTATGCGCCCTTTGAGTTTAATTGACTTGACTTTGTATAGTATAGATCGTAGAGTCTATAGCAGCTCCTCGCGAAAGGATTAACGGAGAGCTCATAGT
TTTTCAAGAAGAGACAGCGTAAAATAAGCGCTTTACATTTGACTTCCTCTACCACCGGTGGGGTCTTCCGCAACTCTGTAGGCGACTTAGGTTGTGATCT
CTCTCAGGTGGTACGCGTTGTAGTCCTGTACGTACTTCTTCCAAAATTTCTAGTTCGCATCGGTCTTGTCTTTCACGTGTAGGAGCTTGGCAACATCGAT
CGGCTGCTTTTCTGCGAATATGAACTGCTTTAGCACCTCAGTCTCGAACTTGTTTGAAAAACCCATCGTGTTCGGGTTCTTTTGTGCCACTGTAATAGCC
TTTACCAAATCTTCGTCCCTGTGCGTAGTTGCCAATACGGTCCGAGGAACAATCTTACCAGGGAAAGACTTGTGGAAGTCATCCATGAACTTCATCCAAT
ACGCGAACATTGGGCTTTCGAAGAGATTTGTGGGCATTACCCAATCCAGTTCCAGTACCTGGAACGTGTCATTCGGAGATTTCACCCAGTCTTTCTTTCA
TTTTTGGTGTTGTAAGCTATATTGTGTTTCTGTTTTATCGAATTCCATCCATTCTTTGAACAGTACAGCCTCCATACGTTTTCCAGCACTCTGCGCACTT
GGCAGCCTCAAGGGCCATTTTAGCGACACCAACGCCGTAACAGTGGGCCCTCACGATCCAATTCGTAGCCATCATGATGTCAGGCGTAATAGGTGTCCGC
GAACTTGGTAAACGTGTTGAATAGCGGGCTCGACAGAAAATTGTTCTTGAGACCTAGCATCGTGAAGACGTCGTCCGGGGTTTTCCCTTGGCTCATCCAG
CGTTTGTACTGCGCAGCTTCCAAGTTTGCGGCGAGGTTCCACGTGCTCGGGGTATTTCTTTCCGTCTCGAGGAGTAGCTTGGATAGTCCAACATCTCCGT
AGTGAGTCGTTAGCGTCCCTATCAAAGTGATTTCCTGGTCGGGGTTCCGCTTGTTGTGAATGTTCATGTACTTGGTGAAAGTGTTCAAAAGAGGGTTCCC
GAGAAGCTTGTCTCCAGCTTTGTCGAGTGCCAAAAACGTGAAAACGCCATCTGTAGTTTTTCCGTCGGCCATCCAGCGCTCGAACTGCTCGGTTTGCACT
GTTTTCGCGATGGCGGAGGAACTCTTGGCCTTCAGTGCAGCTTCAACTACCCGCGACACACCCACCTCGCCGTATTGCGACGTCAGTTTCGCGAAGGCAC
TTGTCTTTTGATCAGGATGGGCCGCGTTGAAAGTCTTCAGGTACGTATTCCAAGATGCGAAGGCCGGGTTGCTGAGGATGTCGTCCCCCGCCTTGTTCAG
TTTCAAGAGTGTGAAAACATCGTCAGCGCTGTTTCCAGCCGCCAGCCAGGTCTGCATCTGCGCAGCCTCCAACTTGGTGGCCACTCCCCTCGTCCCCGTG
ACCTTCTTCGCAGCGTCGAGAATCTTTACGACCGCTTCGTCACCGTAGTAAGTCGTAAGTTTAGCGATCGCCGACGTTGTCTTGCCAGGATACTTGGCGG
TGAAATCGTCCACATACGTAAGCCACGTCGTGAACTGCGGGTTGTCTAGTAGTTTATCTCCAGCCCTCGTAAGTTTCAGGCGAATAAAGACGTTGTCGAT
GGACTTCCCGTTTTTCAGCCAGGTCTGGAGTTTCTTCGTGGTGGCAGTCGAAACCAACGCTTTGGCCTTTCAATAACGAAGCTTGGGAGGCTCACTCTCT
CTTCACCGTCGTCGTCTCCGTGAAAGTGATGAAACCCACTGGCGGCGAGCTGATCGTGATTCGCGATGCGTAAACGGGCCTGAGTCAGGGAGTCCGGTTG
AATAATCTCCGATTTCTTGTGTGCGGAGGCCCGTATCGGTACTGGCCAGGAGTGCGACAGCAAACAACCCAACGTAACCCAGACGCATTCTGCACCAGAC
AGAATTTTGATAAGTGAGATAGCTTCCCACGGCCGTCAAAATTGCTCTGGGTGAAGTGCAATCGCACAGTAAGCCTACATGTAGTATTATAGTACTGCAT
GTACCACGATTTTGCGTTGTTTTCGATCCTGAAAGTGCATCTCCATCTGTCTTCCAGGAGAGTCCGTCTGTCGGGATTGTGCTGTGGCTTTGCCTCTTGT
GAGGCGACCGACGCTGTTGTCAAGGTAGATCTGGGTTGGGCTGGGTGTGCTGTCGCTTGGAAAATGGTATACTGTTGAGGTCTTCGACTTGGTCCGGAGT
TTCGCTGCTGCGATAGATGACCGTATTGGTTTGACCCATTGAACTGCAAATAGTGTGTCAAGAGCGTTGTCCGTGCACTAGTTGAATTGCGGATTCTAAC
GGGGGCTGCATGTATTTTATCGGTAATAACTTAACCTGTGCCTGCTTTCGGAGCAAGAGGAAGTCTTCGGGTGATACTTAAGTAAACTATCAGTACTATT
ATATACTCGTAATGCGCAGGGGGGTTACACAAAGCGATTTTAGAGGGAAGGCTTCTATAAAAACACATAAGCGTCAAATAGAAGGCCACTTACCACCGTA
AAAAAAGCGATTTTAGAGGGATTACGGTACGTATGAAACAAACACAATCCAATGCCTTGGGCTATACAGTTCGCGATACCAACATGAGATGGGCTTGCTG
GAGCAATCAACGAAAGCATGAGCGCCATCATGTATCGCGTGGCTTTGACTACAATGCGTGAGCGCCATCATGTATCGCGTGGCTCTAACTACGTATGTGT
GAGCGCCACTACGTATTGCGTGACTCCGACCGTGTTTCAGGTCAAAGCAAGCACAACTGCAGTCCATTCAGTTTCATAAAACGCAAGGGCTAGCCTCACT
CTGTGCATTCACTGATTGCCAGTGACCGCTGAAAGACGGGGGGGGGGTTAAGAACGCGCTACTGCCAGCTTTTCCCCTTCTCAGCCGGCCGTCGGCTTAT
TGGCGTTACGTAGGACGTTAACATAGCTTGTTGTATTGAAGTCAGACTCTGCGATCTTGCATATTAGCAAGGGAGAGTGATTGTTTGCCCTGCCTTAGAA
AGTACAGTGCCGATGTCAAATCTCATTTTTATCATGAGGGTTTTCCGCACTCTGAGCCTTGTCGCGCGCCCCTGAGTGGGTGTCCCTGGCTGAACCGGCT
ACCCCAGTTAAGCGGGCTTCAGCAGCTTCACATGAATAGACCCTACATACTTGGTTTCACTATAGTCCACAGCGTCGCAGCGCTTATCATTGTTCGTAGG
GTCCCAAGGCCTTTGATCTTCAACGTCACAGCAGTTGAAGTCGGCCCGCAGTACGCATCCCAACATCCTCATCCGACCCAGAACAAGCTGGTCTGCCTCT
GGGTAGACCAACGCAGATGTACACGCACTCGGCGTGAGTACAAGCACCACATAGCGACTTCGGCCATGCATCGGGGAGAAGAGAAGCTTAAGAAGAGAGC
AACACAATGGGAGAGTCACAGTACGGCTGTGGCCCAAGGCTTGGCACAGCTAGAATGGAAGAGTATCCGAAGGGTGATTGGTATGGGGCCGTGGGGGAAA
CATCTTCTTACGTCTTAAACTGCACGCCATTTCAACCTTTGACGCCGCAAACAGCAAGCTGGGCTGCCCGCATGAAAAATGCCGACGCCTGCACAAAGTC
ACGCTGCATCACGTCTTCTGGGGTGGGTGGGGGTCAGGCGGCGGTGAAACTGCGGCAACACATGATTAGCTCATGGAGGGTACTGGGCCTACAGGAATCA
GGCAAGGAACAAGTCATCTTCGGCTTGAAATTACACGAGATACCACGCAAACTGTGGAACTACGTGGAAGAACAAAAGAACATCGCACAAGTCCTGGATC
TACAACTGGCGGAAGCGGTCATTGAACTGACAGAGGGCTGCTGGAGAATCGGAGTGGCGGTCTATCTTCATGCGATACAGAGGTGGAGAGCGAATCACTT
TGATGAACTCAACAAAATGAGGGTAGGGCATCATCTTGCGACGATGTCCAACAAATTGCAGCAGGGGTACAGCACGGTAATTACTACATGAGACCTAGTT
TCGGTACGAAAGTAGGCGACGCTGCAGACAGGATAGTACGCATGGCACTTGCTAGCGCAGGCGCCACTAACCACGGCATGACAGGGGCCCCAAGACCGGT
ATGCGGGTACATACGCGCACGATTTTTACTTTCTTTATTAACCGGGTCAACTTCTGGCTTAAAAGTTCTAAGCTAACTCCCCTGAGTTTTGATCTCGGGG
CAGCGCAAGGAACGTTTTTAAAAGTATTCTACCGCCCTGCAAGAGGCGCACCGAATGTCGGCTTGTTGCCTGCCGGTATTAAATTTTAGTCAACACCCCG
TCATCGTGATGGCAGTGACGGTGACAGTCATTAGAATAAGGGCTGTGATTGAGGAACGCGGCAGTGCTTGAGAATGTACTGAGACCAAGTATGCTTCTCT
GGATTACGGACCCGCAGAGGAACACCTGGCGAGGAAACACAAAAGTATAAATCTTGGGATCTGCTCAGCGGGTAAAAACAAACTCCTCAGCACAAAGCCA
GAGGAGTAAGTGAACGGAGGATGGATTTTACTCAGACAAGAAGACGATATGCCATGGCATGGAGCGGCAGCATCAGCATCAGGTTCCCGACCCAAGGAAC
TCGACAAGCCAATGCGGTGAAAATTCTGGATAATGGGCTCCAAGAACTAAAGACGCTCGGAGACGCAGCAAAAACGTACCTCCGAATCGACAGTGTGGAT
AAAACAATCCAGAAGTGCCTCAGTGCAAAACCAGCGACAACACTGAACGACAGCCACATCCAGGAACTGGATCAAGAGCTACAGCGCTTCTTCGTTGTGC
AATGCAGCACACCAGCAAAAGCCGACCTGGAAGCAGTTCGGACACTGACACAAACCCACAAGACTCGACAATTTAACCTACAACAACCAAGCACAACAAC
AGACCCGATGCACAGCTACCTATCAAACTTCAATACAAGATCAACCAGAAGCAACACCACCCAGACAGATGAACGACATCAAGTCGCGTCTTTTATATTA
TCAAAAGACTTCTATAGAAAACACATAAACATCAAATAGAAGGCCACTTATCACCAACACCACGGGTAAAAACAAAAAGAAAACAAGGGGTTTGTGTACT
GTACATTAAATTGATAAAATAAACCCAACTTGCAGTGAGCGGACCACTGTGCAACTTGCACTGCAAGTTCCATCGCCATGAACTACCTGTTCCAAGTATG
CAGCACATGTTTGATACCCCACCCCCATGCTTGATAAGAGGGTAGCCGCCAATAGCACGGCGTAGTGGACACGCATGGTGGAGCTTTACACGCGTTGGTA
CCCGAGTACTGAATTGATGATGATAATTGGCCTTTTATTTAGTGTTATGTTATTTGCCTATAGAAGCCTTGTAATATGTAAGGCGCGACTTGATGTCTTT
CGCCTGTTTTGGGGCGCGTTGCTTTTGGTCGTTTTTGCATTCCAATCGGCGAAGATATGCGAGTAGCAGAACTCGTGTGGGTCTCGTAGATTGTAGTTTT
TTGCTGTCCGCGCTTTCGCCCATAGACGTACTGCGTCGAGGCTTGCTTTTGCTGGAGTTCCTCATTGGACGACAAAAAGCTGGTGTAGTTCTTGGTTCAT
TTGTTGTTCTGGGCTGTGGTCTTCCTTTTGTTCCGTACTTCTGAATTGTTTTGTCTACACTGTCAAGTCTGAGGTACGTTTTTGCTGCATCCCCGTAGCT
TGGAACCCTTTGTCCAGTACCGGTATACCCATCGCATTACCCGAGTGCTGAATTGCGAATTTCGAAGTGAGAAAGCGGCGCCGATCTCCAAACAATGGAC
TGGTCTTTAAAGGGGCTCACGATACAAAACGGTGGCAGTGAGCGTCTATACCTGGTACCAAGCTGTGTGTGTGGGGGGGGGGGCTGAAGATGGCAGCGTT
TGCAATGGGCTTCTTAGAACTGCGAGCCAGGTGACTGCAAAGGCGTCCACTTGTACTGTCGCGTCCAATACTAATGGTACTCCTGGTGGACAGGGCTACC
GGTATTGTGTTCACAACGTGCTGAAGCTGCCACGGCGACAAGCAACTCCACAGCTAGGTGCTTTCTAAGGAAGCACCAAGCCGCAAACGCGGACGAAAGC
GCTGAAGACGAGGAGAGGGGATTCGGTACCGGTATCGCCTTCATTGACGACATCATTCACAACGCTGGCACACATTGGGATGATTTTGTGCAGAGCCATC
AGCTCGACTCTATGCTGAGCGCAAGGACAAACTCTAACGATGCCTATAAATTACTAAATGTCGACAAGGTGACAGGCAACCTATTGCAAAGCAAAGAGTG
GAAAGCGTGGTCTACGTACGTGGCAATGCTCGACAAAAGCAATGCAGATGAAGCAATGGCGACGTCATGGTGTTTCAACTCAAGCCAGACAAGTTGTCGA
AGGTGCTGGCAGAAGCGGCGAAGAACCCGAGCACGAAGGACATTGCTGCGAGATTGGAGAGTGCGCAAGTCAAGTGGTGGGTGAGCTTATCCGGCACCCC
AGATGATATTTTCAAGACGCTGAAGCTCAATATAGCGAGGAGCGATATTTTTGAAAGTCCGGAGCTTGCTACCTTTACCAAGTATCTTGACGCTTTCAAC
AAGAAACCGCGCAACGAGCAAACAACTCTGTTCGAAGTCTTAAAGAATAGCTATGGAGATGAAGCTCTGATGAAGTTACTCGTTTCGGCACAAAATGCCA
AGAGTGAGGAGGCGACGAAAATGATGGATGACATACTGGCTGGCTGGCTGGACTTCACCAAGTCGCCTTACAGTCTCTTCAAGTCGCTGAACTTGGACAA
GGCAGGAGATGATCTCCTCAGCAGCCCTATCTTGAGCACCTGGGTCAAGTACATGAACCAATTCAACGAGAAGCTCCCTACGAAGAAGACAACGATGATC
GAGACGTTCATGAAGAGCTACAATGACGAAACACTGACCAAAATGCTCAATGCGGCGAAGAAGGTCCCAGCTACAGAGCAGCTCGCCACCAACTTGGAGA
AAGCGAAGTCTGCACTGTTCAGCAAGTGGATGGTGGAAGGGATAACCCCGGACTATCTCTTCAAGAACGTGTTGAAGCTGGATCCAGCGACCATGGCCAG
CAGTCCGAACACGAACATTTGGCGCTCGTACTACATCGCATATGACAAGGCGTACCCTGGCAAGCTGTTCTCGTTTAACCCTTAGAATGAAGAAGCTGCT
TCTTCATGTTGTTCGTTATTGAATTTTCCGAGTGCAATAGCTAGTTTAGTATGATGCGCGTGCACATCAGACTCATCGGTCATTTGAATGAGCTTCCAGT
TTAAAATCTGTGTGGGGCCCACAATGTTCGTTCACTGTCCGAAGTGTTACTATCAACGTCTTGGAAAAGATACCGAGTCTTGTTCTGGATGTCTCCCCAT
TATTGCGTCGACTGTGTCGCGCATCACTATCCCTTGGCATTCTTCGATTTACGCACCTGCGATGCAGGAATAAATCGCGGTTGCACCGCTTAGTCATGGA
GGCTGATGTTCGTCAGCAGCAGAGGGAGAAGTCCTCCTCCGTTTGACGGATCTGGTACAGTTGTTCGTCTGGCGCGAAAGGTTGCTTGGTAGATTCGGTT
CGCCTGGTCGATTTTGCCGACATTGATTAGGTTCGACGAGAAACCTACCTTCGTCGATGGGGTATCGTACGTGTAGGTATGCGTTTTCTGGGTCGTGCCC
CCGGCTGCAACTCCTCCACATAATGTCTCCCACTTTTGAGGTTTAGCAGCCAAATTCTCTGTTCTCAGTCTTGTTTGAGCAAGCTTCGTCGACATTTACT
GATGCGAACAAGCCAGTAGACTGACCCAGTTAGCGCTAGCCGTTGACTGTGCGTATCCAGGCAACAACATGTGGGTCTTTCATTTCACGCAAAATTGCGC
GAATTCGGATTCCTCTTTTATATATTTTCATATATTTTGTCCAGCTATTGACACGTGAACTACAAACTGCAAAACAGCCCACGCCTTGTGAACTTCAGCA
GCGTAAATACATCGTTTGGAGGTTTCCCATCCTTTAGACAACACTTAATTTGCTACAGAGCGGTTGCTGACCATTGACCAAAAGAAAGTCAACTATCAAA
GTTCGTAGCCGAATCTTGTCCGTCGCAGTGGCACTATAAATAAATAACGCCTACCCTTTCTTCAGTATTCACATTCCTCATGCAGGTTTTAAAAATGAAA
TCCAATGCCAATGCAGTTACTAGAATAGCGTATTGGCGTCGAATAGTACTGCTGTTTCCAGGCACCACCATCTAACGTATGTTAACGGTTTAAGCAACGT
TTCCCTACACTGCGTTGGCTTTCTTAATGTATCGCTGGATCATTTCATCAGCGGCAACAACACCACTGAGCAATTGGAAAGTTTTGCTGGACTTCCTTCG
CACGCAGCCACTTGTTCAGCAGTGCGTTCTGCAAGTCTATGACCAGCTTTTCTGTTCTCGAAGCTTTCTTCGCCGCATCGAACATCTCCAACAGGGATCG
ATAGTTGTAGGTGACGCTCAAACTATCGAACATAGTCGTTTTTTGTCGGGATACGCAGGTTAAAGTCACCCAGATACTTGTCCAAGTTTCAAAACGAGGA
TTAGCAAGAACGTTTCCATCTGCCTTGGAAAAATGTAGAATCCATTTGAAAGTAAGATATGGCGGCAGCTGCTCGTTGACGAGCCAACGCTTCAATTGTT
TCGCCTGTACCATTTCAGCGACTTTCACAGTGTTGGATTTCGCAGCCCCTTGTTAATCATCGCTTCAACACCAAACTCCGTATAGGCCTTACGCAGTGCA
AAGTACCAATCCGTTTTCTTTGCTGGGTTCTCTCGGTCGAACTTCTTCACGTAGTCGAGCCAAATCTTGAACAGCGGATTGCCAAGAACATTATCCCATG
CATCGCCGAGCCCGAGCAGGTTGAAGATTTCATCGGGAGATTCTTGCTGGCGAGATGGCTCTGGATCTTCTCCGTCTGCAATTTGCTGCAGTGCTTTCTA
GATGCGGGTATTTCTTCGCCTCCTCGAGGATTTTGATCAGTCGTTTGTCGTTGTAGTGGGTCGTCAAAGTCTTGAACAAGTTCGTTCCTCCCTCGGATGT
TTGTTGTTGTAGACGTTCAGTACGAGCTCCACGTCTTATACAGCGGATTGTCGAAGAAGTTCTTCTCTGCTTTGTCAAGTTTCAGCAGCGTGAAGACGTC
GTCCGATGATTTACCACTAGTCAGCCAGACTTGCATCTGTTGGGTCTCCAACTTTGTCGCCACTGCCTTCGTACTGTCAAGTGTCTTTCCGAAAGCAATA
ATCTTTGCCAGAGGTTCATCCTCGAACCTCTTCGTCAAAACATGAAACAGAGTTGTTTCCTTCGCTGAGTACTGCGCATTGAAATCATCCAGGTACTTGA
CCCACGTGCTGAAAAGCGGACTCGCCATCAGATTATCCTCTACGTTGCCAAGTCCCAACTGAACGAACGCATTGTCTGGTGTTTCCCACTCTTCAGCCAT
CCCTGAAGCTGCTGGGCCTCCAACTTGGTGGCGATGCTCTTTGTTGCGTCCAACTTCTTCTGTATCAAGCATCTTGAACAGAATATCATACAGCATGATC
TGGCTGACCTCAACGACCGAGGATCGGCCATAGCTCGTGATCACAACGCTATGATGATCGAGAGGGTCGTCGCCCTTCAGCACTTAGCGATCGTAGCCAC
TGCCGTTGGTGCGTCGCCCCACGTCTTGCGAAAGTGCAAGAGACTCTTGCTCCTCATTCCCGGAGCACCATTTGTCTGCCGAAGGTGACGTTCCGATCAG
GGCATCCCTCACGCAGATCGGGATTCTGATCTGGGCGAGCCGGATTCAGTCCCTCTGGACAGTCAGCCCAATCCTGAGCATAGCGGGAACGGATCTCCGG
TTCATGACCTGCCTGAGACGTCAGGCACCTTGGATCTGGACAGCGGCTCCGGTGGTCCACCGAGTGACCTCCCAGGATCTCCGGATCCTGCCTCACCCAA
ACATCCGCGTAGCCCGTCCCCTTCATCCGGGTCTTTATCTCTTCGCCCCAACAAGAAGGCTCGTCCCGTCGAGATTGACGATGACGACGGTCAGGAGGAC
GCCCTCGACTTTGATGACGATGGGGGCCAAGATCAAGCATTTTCGGACCCCGGTTCTGGAGATCCAGAACATCCTCGTGAGGACGGATCGGAGCATAGCA
ACGGGTCCGGCCGGCGTCGTTCTCGATCTTCTTTGTCCAAATGTCGGAAGATGCTGAAGAGCGATGACGAGGAAGACTCCGCTGATGCTGAGGACGCTGA
AGAGACCTTCAATCAAGACACCTTGCGCGCTCTGGCTCAGTCTCAATCTGAAGATCGCCGCCACAAACACGCAACACCCCCTCGCCGATCGTCGCTCCGA
CAAGGCGCTGGCAGATCGGGAGATCCGTCTGGATCTCCTGCCGGATCGGATCACGGAGGTGGATCCCCACGTCACGACGCTACTTCCCCTCTGATCCCAG
CTTCCAGCCAACACCACCTACCTGCGGCTCCGTTCGGACCGATGCGATCTGCATCCGGGACGTTCGAGCGTCGAGTGATGTACATGCAGGATGTGGAGCC
TTGGATCGTCCGCATTCTTAACCAGAGCACGATCATGGACATCACGATTGCTGTGCTGTTCCCCACTCTCCCGATCCGACCGGGTGGATGTTCCCTACGG
ACGAGACTGCGATGCCGCCGCTGCGAGAAGACCAATACTGCGAAGAGCTGATCACCGAGCAGAACGTGCGGGATCTGTGGCGACTCGTCCCTGGAGGTCT
TGGAAAACGCTGGCCAGGCTATCACCTTCGATCCAGCTGCTGCCGGCGCTTGGGACAGTTCGCCCGAGAGTATTTAGTCCACGAGACTCGCGATCTGCAG
ACTTACTGGGAGAGCACACACTCTTTCCCGATCTCGAAGGCTAAGTGTTCGGCCAACCCGTGGTTGGCTCGCTATCGCAAGAGTCGTAGTAATCGGCGCG
GTCACGCGGGAACTCGCTGGAAGCATGTACTCTGGCTCCTGATCTTGGCTATGCGGATGGTGGTGTGATCTAGATGTGCTACTGGACATTTACTTCCTTC
ACTTCCCCACCAGATCGAGAAGGTCACGTGGTACCTGGGGTCGTTTCACGCCTCGCGAAGCTGGCTAATCCTCTGGTATCACAGGACGAGCCGACAACAC
TCCTGGAGGCCCTCGATGAATGCAACGAGGCAGATCCTTGGCGCAATCATTTTCGTGATCCCCTCAAGATCACCCGGCGTACCGCCTTACCCGCATCGCG
GGCAAATTCCTCGGTGTGCATCCTGCTACACCAGCTACTCCGTGATTCCTGAAGCGCGCCAGCTCAGGTAGATCTTCCGTCTCTTGATTAGCCACTCCTT
CATATTGCTTTCCCAATTCACCGATTTCAGATCCCGATCCGGGGCTGTCACCACTTATTCTTCGTCGATTGCATACTCATATGTTTACATACATCCCACT
CCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGTCCCGCCTCACTATTCTTCGTGAGACTGC
ATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGCAACAACGCACCACAGTTGAGATCCGCTTCGTCGATCCAGCTGGGCTCCTCAT
ATCCACGCCAGTGTACTAGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGATCTCAGATCCGTGATCTTCTCGACTTCGTATTCATCGGAT
CCAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCACAACCAGCTGAACGAGCGGGCGATCTGGGAA
TTCCTTCACCAACTTCAATTTCGAACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACCGCGTACTCATGGATTTTCTCTG
CCACTCGAAATGGCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGCGAGATCCAGCTTCTATCGGGTGGGGTCGGACG
TCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCGTATAATAACGCTGGATCCGGTAGCGCC
ATCGGCGTGGATCACGATCTTGACGTCGGTACTACCCACCGGGATCGTGGCCTCTAATGTAGATCTAGGATCCCACCCATGTACCAAATAGAAAGGCGTA
TCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCCAATCCTGTTGATCCAGATCCTGGACATGCATCTTGA
GTGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCTCTGACGCTGTCCTAGGATCTTGTTGAACG
CTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGGCGGAACACACATTCTTCGTAGGATTCCGCTAT
CGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGTGTTGCCTCTATGCGATTTCGGC
AGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTTGGCCGACCTTTTCCGGTCT
CGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGATCCGCTGGTAAGTGCGGCCGATCCCTTG
GTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCGCATCGCGAGATCTCGATCTTCGTCAGAC
TTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGATCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGCTTCTTCCTGGGCCAACGTAGCTACA
TCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGAGCTCCCTCACCAATTCTTCCTGCA
TTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAATCGGACCACGGATTCTCGGACTGTGACGGTTAGAATCTCGTCCAACC
GGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCATCTCGCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGGAACCATTCCAGT
CTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAAACCTGGGGCCTTACAATCAATTTC
CCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGGTCGAAACACAACAAGAGACCATTATA
CTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATCTGGTAGTTTCCACAGGATCGCGCTGTACGCGCCTCCTC
CTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACAGGAGCTTGGATCTGCCGTCGGGGTCTTTC
TTAGGCGCGATCGCGATCAACGCCTCTCCACATCGGACTAGGTGTAATACTGGCAGCCATCGCCCCTAGGATTTCGTCTTCACCTTTGGTGCACTTCATA
ATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAACAACCATGCTAACGTCGAATGTCGAGTTA
GGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACACTTCCTTCTCGACCACATTATAATTCAGCTCGTT
CGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCGGCGGAAATAGCCCATTCGCTAGCGAAGACAACT
ACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGCAAACGACCTATATGCTCTGACCCATCTCT
CGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGACGAACTGTGATCCAGGATCCGACGAAG
ATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAGTCCTCGATAAATCGGCTGTAATAGTTC
AGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCGATGCCATCGTCGG
ACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCACACGCTTCGAGCAGATTCTCC
ACCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCCTAACACTGACGGACGACCTGGATCTTCCGGTTC
TCCAGCCTCAAAGATCTGGAGCAAGTCCTGGCTCGTCAGGGGGGGGATCCGTGTAAACCCATATAACGCATTATCCAGAAGCCGCTGATAGATCTGAGGC
GCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGCGCGAGCTCGGTCCGTCATCGACGACCCAA
AATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATCAGAGGCATGGGGTAGATCATTAGTCGAGTGA
GACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTGATGATCACCACGATCGGTGATGCCCACGGCGATGTCGAATGTCGA
ATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTCCGCACCCGTTGCACGATCGGCTTCGCACCTC
CTACATCGATATCACATACGACTCCTCGGGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAACAAGTGTCGTTTCCGCCAGATGATCTGCCGCAGACG
ATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCGCTCGTCATAGCCGTGATCTCTGGCAATACTGCCATC
TCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGTGATAAATATGTCATCTTCCGGCGGCTCCGCGACCTGTTTTTGGTTCAGTTCCGACTC
CACCACCGGAATCGACCGATCTGGATCTGGATCTTCGTACGTTTTTGGCCGGTACTTGATGTGTCCAGTCGATCTGGATCTGGATCTTCGTGCCGTCTCT
GGCCGACACTTGATGTGTCCAGCTGATCTGTCGGGATGGGCGCCGTCGGATCGGCACAATCGCTGGAAACGCAACCAGACGGGACATTCCGCATCTGATC
GGTTTCGGCTGGGATCTCGACGTCCTGTTGCTCCGGCAGTTTTGGTGGGCAGGTAAACCATGTCGATCGGTTCGGCACTCAGGATCCGGTTGATCGGCGG
GATTGCGTCTACCTTGATCTTGGCCATCCACGCCTAGTTCTGCGTCCACACCAATTATCCTGCTCCTCCTCTTGAGATGGGTCAGCGGTTAGAGCCGGAT
CAGGGTACTTTGGTCTTGATCTGGCCTTTCCGATGATGGCTCCGTTGCATGCTCTGCACCTGGGCCTTCTTGATCATGTCCTGCCGCTATATCCTGGGCA
ATCTCCACTCCTTCCTGCGATCTTACAACATCCGGATCCGAGTCTCCAGTGGCGGGCTTGCTCAGATCAAGAGTGATCTGGGCGATCGGGTTCCTGCGAA
GTATCGCTCGTGGGGTCACATATGTTGGACGCTCCACGGCGGGCCCCTGATCGAGTTCCGGTGAATTTGCTTGCGTCGGTTTCGACTCCACGGTAGATTC
GAGTACTAGATTCTGCCACTCCATGTAGCGACGAGATCCGACCGAAACGAAACCTGGCAGGCGGGGAACGCGGTCTCCAGCCAGCCACATGCCGACCTTC
TCATCGCCTTGTAGAATTAGGACCTTTTCACTGATGTTGGTGATCTGCAAGTACCGTGTCCTTCCTGGTCCTTTGACCACGGTTGGAACCCAGCGATCTC
CGCGAGTGATCCATAGCTTCTCTCGATCGGACAGTCGCAGTCGTATAGGCAGCTCCACTGTTTCTCCCACTCCGATCTGCATGTGCTGATCCAGCCGTAG
CATCTTCACCTTGTCATTATAGAGCTGGCGTCGTCCGCTAAGCTGGATCTGGACCTCATCTGGCAGACAAATGGATCCGTCGGCCAGATCCAGTCTGATC
CCGGCTGGGACCATGAAATCCATGCCTAGAATGGCTTCCTGTCCGGACAAATCTCCAACCCAGATGTCGAAAAAGTACACGAACACTCCGGCTAACGTGA
TCTTGATCCGAGTTCTCCCCTCCGTAGTGTATACGTTCTCGCCAATTCCAACACATTCTTGGCTCTGACTCGTGTCGATATAGCACCCAACCTTACGAGC
AAAGGTGGTGTCCACAATGGACACCTCGGCACCTGTATCTAGGAGTAAGATCGCCTTTTCATTGTTGATCTTGCCAGTCAGCTTCGCTTGGCGAAACCAT
TTCCCCGGCGCATGGTGTTTCCAATACCCCCTCGACTCCCCGGGTAGGAGGTCCATAGAGGGTCTGGCGCCAGATCTGCGGAATTCACTGACGTGGGGTA
GATCCAGATCTGAGGTCGCAGTGACAGCTTCTCCATCGGTTGGTCGAAACCATTCCTCTTGGTCACGCTGGCCCCAATATCCGCGAAATTCCCAGACTGT
AGATCTAGCGACACTTCAACCTCCGATCGGTCAAATTCATCTGATCGCAGGCTGGAGATCTTGGCAACTTGTTCCTCGTGCAGATCACATGTATTACCGC
ATAGATCTGGTCGTTGACTACCTTGATCTAGCGATAGCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTATCGGTTTCCAAACCGA
CGAGCGTCCTAGTTTAACATCTTCTCTGCCATCGCTGGTAACATCCCGGCATGCTTGGTCGGGTTGTACCACTGGCGGATCTGGTTGTAGAACTCCTCCA
TCGGACATTTGCCCATATCATGAAGCTCGCCACATCCACGGCAGACAAACAGGCAATGATCCGCAGGGTGCCCTCGCTTGCCACACTAAGGCGTCTCCAA
CAGCCGAGATCCGTATGCTTACGGGATCCACAATGCGAACACCGGTTGTGATCCGATCCGTCGAATCTACCTTGAGATCTTGGATCACGTGGTGATTTCT
CCGGCGAATTCGAGTTCGTCCGTAGTGGGTCTGTCGGGGGCGGGGCATTCGTCACTCGCGTGACTTCTCCTCGCCCGAGGCCAAGTAGATCCGGCGCAGA
TCGCCTTCTGCATCCGATCCATCCGATCTGAGCCCTGGATCTGGATCGCATGTACCGCTCGCTTAGCTGGAGCTGCCGGAGCTGTCGCTGCCGCCTTCTG
TCGGTATTTCGACCCAAATGCTGACCGCTTCTGCCGGCTTTTCGCACGTTCCCTCGCTCGGAGGACTTCTTCTAGTGCATCGGCATCTGGGAGCCGTAGT
AGCGTCAATTGATCAGCCAGATCTTGATCTCCGAGGGTCTCGATAAAGTGATCCACATGTTCCCGGCGATCTTTCGGTTCCCCGTCCTTGATCTTGAGGC
GGGTACGTAGAGCAGCAACGTTCAGACGGTGGAGATACTCTAGTGGTGATTCATCCGACCGCTTACGTGCGTGATAATACTGCCAGGCAACCGAAACACC
TAATCCACAGTATTGCACCTGGAAACAGCGCAGCAGATCACTCCACTTGCTTCGAGTGTTCGGCTTAGCTGGCGGTACCAATTCTTGGCTGGGCCAGCAA
GTAGATCTGCAAAGGTCAGACACTTCTCTTCATCCGAAGCTTGGTCTCGGAGAAATGCTGACTTGACCTTGCTGATCCAAGATCGAGCGCGATCTTCATC
CTGATCTTTACCCAAGAATTCCTTCAGATCCGAGATCGCCGAGATCCGAACCCTCTGAATCATGGAAGTTCCATTGGATCCGGCGGCTGCGGTGGCCACG
GTGACCCGTCCTGAGCGTGGAGCTTCGAGATCGTCGGGATCATAATCCCATGGTGAGGGATGGTGGGATCCGACTGACTCCATGTCCACATCTTCGTACT
TAGGTTCCGCGGGCACTCGAGGTGGATTGATCACCTGTTGTTCTTTGAGGAAGCGACTCATCGCAGCTTGGAAGTAGGATTCCAAACTGCTTGTCGTTGG
ATCTGTCGTAGAGGTGATCGGGATCGTAGCTGCGGGCATCGTTGGTTTTGTCCATGGGCTTTGCGCTGCGATCGTAGCCACGGGCATCCTTGGCTCGTTT
CGCGAACGTGGCTTTGAGATCGGGATCGCCGACGTGGCCGGCTGGTCCCGCGGATCTAGTGGTTTTATATCCGCCACTTCGCGCGGGATCCGATCAGGGC
CATTCCGGATGGGCCAAGAGGCATACGTCGTGGATCTGCAGAGCTGTCCGAGTCTGGCTCCGAAGTAGCTGATGCGTAGTGCGAAGATCCAGTCTGGCAC
TCTGCAGTGCTGACCTGAGGCGATGGCTCGGGATCTTGGATCTGAGGGCTTTCGCCTACCAGAAGCTTCAGGCAATCAAAGAGGCCTCGGTTCGCATAGT
GAATCGTGTCTAGATCCAGATCGAACAGCTCGTTCGCTTCGAACGCTCCTGCCACCAAGCCTGAGTCGTCCAGCAACCGAAACTGCTCCTTCACAGCGTC
CAGCTTGTTGGAGCGGACTCGTGGTACTGATACCGGTCCTTTCAGAACTCCGATCTGCTTCGGGATCAGGATCTTCATCATCGGATCCCGGCGTAAGAAC
TCACCTAGGTTCTTGCGATGGTACGCATATTCCAGTGAGTCTTCGTTCCATAGTAGCGCAGATGCACCACGATCTTCGGCATCCGACTCTGGAGCTTTCA
GTTTCTTCCGCAGCCTTGCTCTTTTTCTTCTTCGTGGTGGATCTTGGCGCTGGCGGGTTTGTGAACGAATATGGTTCAGGCTTTGCCTTCACCTCATCGT
TCGGCAGATCTCGATGCGAATCGAGATCTGCGGGGGTCCCCGAAGGGACCTGGGGAGGAAATCGAGGTTTTTCTTCTAGATCCGGGTCCGGATCTCCCTC
TTCTTGTCTGTCGGCAGAGCTCCTCCCAGGGCTCTGTCGATCTGCGGATCTTGCTTCATTCAGCAGCGTCGTCGATCCGATCTCCGATGACGCTTGGTCC
CCTGGTTCTTTCTTCACTTGAACATCTTCTTCTGCGAACTCACGGTGAAATCCTGAGTCGCCAAGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGG
ATCCGTCAAAATCTGGTTAAGACTGGATCCGGCTTCCCAACTGCCCAGACACCAACTAACGGAGGGGGTCCCCCGATGATCCGTGATCTGCTGAACTTCT
CACCTTGTGTACCCGTTGGTGGGCTGGATCTGCTCTCTCGGCGCTCCGAAGAGATGTGGTTATGTGTTTCTTGACCGTCCTGGCGGGACGCGGGGATGGG
GTGGAGCAGCGCGGAAGTCTTCGCTCTGCTGCCGGTTATGGATCCAGATCCAGAGCGATTCAATCAAGCTCTGATCTGGCGGCCTGGACTTGATCCGGGG
CCGGGGTTGCCTTTGGGGTGTGGATGTCTCCTTCCTTTGCGTTACTTGCCGCTTCCTATAGCGGGGGCTCTGGGGTTTGAGAAATCGAGAGATCTTCGGG
CCAAGTAATAACTCCGTCGGATCTGGGATCTGCACTTGATAATAGATCACTAGAGTAGGTAAGATCTGGCCAATATATTATCCAGACTTACACAACCACT
AGATCAGCTACTCCTTGACTTGCCAACACCTTGTAGGGCCAATGTAGTTCCCGTTTCTTGGCGGAGGCGAAGCACTCTTGTAGTTCAGGGCAAATTCGAT
TCTGATTTATGGTTAAGTCCTATCACATCCTTGATCCTATCCTGCATCCACTCATCCACGGTGTACGACCGATGTGTCTTTTCTACCATCTCCCATCCTT
TCCGTCGTCCTCTGTACGGGGTACCTTGATGTAATCACCTGATTGCGATACCTCACCATCCCATGCTCCACTATTGGGCGGGATCCGAGATCAAGATCCG
GGATCCGCCTCGCCTTAGTACCGGGCCAGATCGTGATCTAGATGGAACCTGAGATCAAGATCCGGGATCCGCCCTGCCTTGTGTCGAGCCAGATCGTGAT
CCGGGCGAACTTTACTGTGGGGCCAGATCCCGATCTGGCCAGCTTCGGTCCCCAAGGCTTCCCCATCTCGGCGATGCTTGATCTGGGTGCGCCGTCACTT
CCTCAATCTGCACATCGCCCTCTTTGACTTGGCATCGCTTTCCTTAACGATTCTTCCACGACCGCGGTGTACCTGAGTACACTTAAATCTTGATCCGACC
TTGGTACAGCTACGCCCTGGATCACCGCCGGATCTGCACCTATGGCGGGCCCATCACTCGCCTCGTCCTTTCTGGTCCTTTTCTTGGCGGCATCGCCATC
TTAGTCCGGATCTCCAACTGTCATTGTCTCGGGACTGTGACCTCTGCATTTCATTTCCGATCGCATTTTCTGGAAGGTACTTCACCACACAACTGTTCAC
GTCGCAGTACTTCACAGACTGCATGTAAGTGCGCCACATGCTCTTCCATACTTTTCGAGAAGACGCATATGTCGTCGAGATACACGACAACAAACTCAAA
TTTATCGAACAACGTGTGCATTAAATGAGACCATGTTCCAGGCATGCCTGCCACTCCCATAGGCGCAACACACCACTGGTCCGTTTCTTTGTGCGTTCGA
AACGCTGTGTACGGTCGACTTGACTTTACCACCCTCATCTGATGATATCCCTGCGCTAAGGCGATCAACGTGTAGATGACACAACCTACCATCTTATCGA
ACAGTTCTTCGATTAGAGGCAACGGAATCTTGGCGATAACAGTTACACTGTTGAGATAGCGGTACACCGTAATGGAAATTGCTGATTTCCGCTACATAAC
CACTCAGCTCTCTTAGGCATCTTTCCCGTGACTGGGTCCTTCTTCGAAATTGCGAAGATATTCGAAACCCATGATGAGTTCGAAACTTCGATCCAACCTT
TCGCAACGTGTCCTTGACGAATTCCTCAAAAGCCTCTTGTTCCATTTTCGACATCCGGAACGGAGCTCGAGTACTCGGTTGCGCTTCCTTCTTCAGCGTG
AGCTCGAAATTAACTTCACGCATTGGAGGCAATCCATCCGGCAACTGGTCAGGAAACACATCCTTGAACTCTTCTGCTACAACGTTCCTTATCGGCTCGG
GAACTGCTTCCAGCTCAGGCACGATTTATTGCTTCACTCGGTATACCTGTTCATACTCGCCTGCGTGTAACGCATGCGTGAACGTAGTTCCATCGACGTC
TGCAAACTGTATATGTTCTGGTATTACTCTGCCAGTTCACTTGTGCATTGAACTCTTCAAACCACGGTTTCCCCAAAACGACGTCGTGCGACTCTAATAG
TTTTCATTCAACGAACTACATCGTTGGAAAAAATAACCGTCCATGCTCACCGGCGCTTCAACGTGCTTGACATCCGTTGGTGAAGTCAGCTTCCCATCAA
AGCGTTGAGCCTGCAAGCGTCTAGACACCAATACGATGCTCGCCAATCCTGGCTTAATCATGTTCGTACTTGCACCCGTGTCCAACAGAATTCGGACATA
TTTGCCATTGATGCGACCCTTCTTAATGAAAAGGTTGCTCTTACGTTCGGACACCTCTGCATTGACGCTTACGTCGGTCTGTACACTTGACGTTGGTCGC
GAATCCTGCTGAACCACGTCGACTTCTGGATGCGTCGCATGCTATTCAGACTTCTGCTCTGGTGGCGATGCGCACTCACCAGACTCCTCTTCTGAAGGCA
TCGCATGCAATTCAGGTTTCTGCTTTGGCGGCTATCCGCACTCACCAGGCTCTTCTGTCGTTTCCGACACTGCAGTGAAAGTCTTTTCCACTTCCTTACG
CGTCTGTTCGATGAAGGCTTGCAGCGCATCCGCTTGCTCCTGGATGTCTGCAACGTTCATCGTCACGCGGTCCATGATGACAGTGTTCATCTTACCGTCA
TCGTCTTCGCGAAACATGTTGATTCGCGTGATACCCCCTCTTTGCGCATGCAAACCCGCGTTAGTGTACTTCGGCGCGCTACGTTTTGCGTTTTGCGTCT
GCATCAGCTGTACAGGACAGTCCCTGGCCCGATGAGCAGAGCTACCACATCGGAAGCACAAATTTCGGCGCATACAATCCTCCTTCGAAAGCACCCTCAC
GTTGTCGATCTCCATCTTTTTGCTTGTTTCTGTTTCTTTCGTGCCTTTGCTGCTACCCTGCATGTTTTTTTTTCTCTTTTTTCTGTGGCACTTCTTGCTT
ATCTACATAAATGCATATTCACTGTTACTATATGCATGGTCACTGTGACTGCTGGCCCATCAAGACAGCCGTCACACTGATAAGTGCTTCTGGGTGCTTA
GCAAGCATGACAGAGCCTTTGCGCCCATGCGCTCTGGCCTGCTTGCTAAGCAGCCAGACGCGGGCATGACAGGAGGCCAATGTGACGGCTGCTGCGAGTG
AAGCGACAGCCAATGGCGTCGCGTTGCCTGAAGGAATAGACAACAGTGGGCTCTGAGACGCGGTAGTAGTACCTTGCTCCCAATGGTTATGTGTCTGCGC
TGCCGGACCTTGTGAGTATTGCTTGGCTACAGCAGCTCGCACCACGGGAGCAAAAGAGCAAGGATAGAGTAAATGGCTACGTCTAGACAGTCATGAGAAG
AGCGCTGGTGGCACAGGTGGAAATCTACGACCCACTGAGTGTCTCCCAGACACTGGCTTGCAAGGATGCTGTCGTGAGTCTGGCGAATGAGGTTCCAGAA
CGCTGTCAACGTCGATGTACCACGTGAGTATAGGCCTCAGAATCATTTCTGTTTTGAGTGGCGATGCCTAAGCGCAGCGCACTTATTCTCTCGGTAAGTG
GGGATATCGGGGACACACAGTTTTCCGGAGAAGGTAGCTTGGTGGCAACCAACTTGGGGCAGCAACAACTGGTCTACCAAGCCGAAGCCTTAATAATTGC
TAAACACTGTGCAGGATACCAAACCTCCGGATACCACGAATCTGTTACTTCGACGCTTCTTGACCAATTCGAGTTGACTTGAGTGTTGAAGAAGATGTCC
TCGGCGAATGTGCAACTGTAAGTGTTCGGTTTCCGCCGGCGAAGATGTCGAAGACGTCGCCAGCCAAAAGAGGAAAACTGTCTTTTTTGATCGAGAGGAG
TTGAGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGGAACCGA
CTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTTATAGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAAACAA
GTGCCTAATGGTTGTCTCACCGCCAACCGGTACCACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGGTACACGTTGGTGT
ACCCCGTTACATCCTCCCCCATTTATCTGAGTATCACATCTTATTCTCCAATTAGAAGGGAGAGAATTGGAACTCCCAAATTGGGAATTCCCGGGCGCAG
CCACAGCACGGCTGGCGCGCCCTCTCGACAGTCACGCAGTGACTTGTGTCCGTGGCGGACACTGCGTGGTGCTTCCTTGCACAAAGAACGATGTCGGCCG
CGAACCCGACGTCCTTAGCAACTCGCGTTGCAGCGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTCGTTG
ACCACCGGCAGTTCACTTGGGAGGAGCCGTGCCCCACCCTGACACTTCGTGTGTCTTGTGTCTCCCGTGTGGGTCGACACCATCCCGGGCATCACATAGC
CCAAGAGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATTATAGCGGACCCGCATGGCCCACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGTGCCGTAC
ACGCGCTCTGGTCATTCGTTGACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGATACGACGGTTGCCATTAGCAGCCTGCTCATCACCAAAAGCATTT
CGGGTAGAGCAGCAAGCTTCACCCCGCGTCTAGGTCGTCGTACCAAAGACGCTTCGGTGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCAT
GGTGGAGAGTTACATGCACTCTCTACCACCTTGACTCTGGTGCCAGCGATTGCTTCGTGCATCGCCAAGACCAAGACACGGTCGGAGTGTGTGCAAGCCT
GCACGACACTCGGTCTTTTTCATGACCACGACGGTGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTACCACTAGAACATTGA
GATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCACATGTGACCGCGTCGGCGTACGGGGCTGTGCTCCCGTACGCCAGAGGTACGCCGTGTG
CTCAATGTACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGATTCTGTACAGTTGTTGGTTCATGCCAACAACAGCTTCCGTGAGGATGCTAGTC
TCCCTAGAGACTTGGGAGGAGAGGTATTTCCGAACCCCTCCCCCTCTTACGATCGATCCCCCTCCGGGGTGACCGAGTCGACCGCGGCTGGAATTCTTCC
AGCCCGGGAACAGTTTGAGTCTGTGCGACTTGACGTGGGAACGAATACCCACGTCGGGTGAAGCCACCATGGGCTCACCTGGTGTGTGGAACTATGTTAC
CCACACAGGGAGCGCAACCCTCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGCCGCGATATACATTGCGCCAGGCATG