Description :
From Genome Similarity Track
Location :
contig_50:548- 27506
Transcript NameFunction/comments
g9887.t1hypothetical protein
g9888.t1POM75861.1 Avirulence protein (Avh) [Phytophthora palmivora var. palmivora
g9889.t1POM63598.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
g9890.t1hypothetical protein

Sequence
26958 bases(100 bases per row)
ATCGTCCCGTACCCTGGTCTTCGCATCAAGTGTGAAAAATCGATGCAGTGGCTACGAACATTCGTATACGAAATGAAAGGGACTCACACACCACCCAACG
AGTGGTGTATGGCATTCGAACTGAGTCTTCGTGATGGCGCCCTTCATTGGTATCATCAACTGCCGAAGAAGACCAAACGTCAGTGGAATCTATTGAGCGA
AGCATTCATCAAGTACTATTGCTCGCAGTTCAACCAGTCGGCGAAATCACGGTACTACACTGCGAAGAGATCGGACAAGGAGCACATCTGCGACTACATG
AACCGTTTAAATGGTTATGCGCGCAACGCCGGAATCAAGTTTGAGCACGGTGGTCGTGAAGCAAAGGACCATGTAAAGCGTTTTCTCGAAACATGCGGAG
ACCGAGAACTCGAGAGGCGTCTATGCCACATGCAAGTGACTAACGTCCGGGTGTTGGAAGACATGGTAACAGACATTCTGAAAACGGACGACAAGAGTTC
CACTCGTGACAGCTCACAATATCCTTCTCGCGGTCGAGATTATGAACGTCGTCGCGATGATCGACGTAACGAGGACTCGGGGCTACGCCGGAATGAGCGT
CGAAATGATGACTCCCGAGAAGGGTATCAATGCCGCAAGAGGAGTGAGACCGACGCCGCGATGACTCGCGGCAGCGACCGAGAGTGACACTAATCGAAGC
ACTGAGCAACGCTATTGCAGAATATCAAGATTACGAAGTATCGTACCCCCGCAGCGAGGGCTCGCACTCACGCCCACGCGAATATGATAACGACGACAAA
GACGACGAGGATTTTTGGCGGTCCGATGATAATGACCACTTCGACGATGACTACAGCGACAATTACGCATCGGGTGATGACGAACGTCACCTGGCAGCAG
TAAAAGAGAACGAACATCACGCTACAGTCGAAGGAAATCACCCGAAGCCCGACAATCGCCAGCCAAGGGGTGACTACACTGGCCGAGACTTCGGAAAGAA
CGGTCAACGCTTTGCCAAGGTAGCCGAGATAACCATGATGTTAGATCTCGCCCGTACGGCCCTTGTGCAGCTTGTGGTGGCCTTTCCCACTCCGCTCACT
ATTGCTACAAACGGTGCAAGCTGTGTAAGCAAGTTCACGATGCCGGAAAATGTGAAGCCTTTCAAGAGCTTACCAACCTGCTCAAGACCAAGGTTGACAA
GAAAGAGCTCAGTCCTGAGCTCCAAAACCTCGTATTCGGCAGCCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTTCCAATCGGGCTGCCAC
AGTTAGCCGAACCCGTGTTCACGGCAGATTGCATCTACGTAGTGCCGACTGCATCGTGTTTGATTTGCACACAAGCCCCGTCTCTATCGACAAAAGGGCG
AATTATGCGCCCTTTGAGTTTAATTGACTTGACTTTGTATAGTATAGATCGTAGAGTCTATAGCAGCTCCTCGCGAAAGGATTAACGGAGAGCTCATAGT
TTTTCAAGAAGAGACAGCGTAAAATAAGCGCTTTACATTTGACTTCCTCTACCACCGGTGGGGTCTTCCGCAACTCTGTAGGCGACTTAGGTTGTGATCT
CTCTCAGGTGGTACGCGTTGTAGTCCTGTACGTACTTCTTCCAAAATTTCTAGTTCGCATCGGTCTTGTCTTTCACGTGTAGGAGCTTGGCAACATCGAT
CGGCTGCTTTTCTGCGAATATGAACTGCTTTAGCACCTCAGTCTCGAACTTGTTTGAAAAACCCATCGTGTTCGGGTTCTTTTGTGCCACTGTAATAGCC
TTTACCAAATCTTCGTCCCTGTGCGTAGTTGCCAATACGGTCCGAGGAACAATCTTACCAGGGAAAGACTTGTGGAAGTCATCCATGAACTTCATCCAAT
ACGCGAACATTGGGCTTTCGAAGAGATTTGTGGGCATTACCCAATCCAGTTCCAGTACCTGGAACGTGTCATTCGGAGATTTCACCCAGTCTTTCTTTCA
TTTTTGGTGTTGTAAGCTATATTGTGTTTCTGTTTTTATCGAATTCCATCCATTCTTTGAACAGTACAGCCTCCATACGTTTTCCAGCACTCTGCGCACT
TGGCAGCCTCAAGGGCCATTTTAGCGACACCAACGCCGTAACAGTGGGCCCTCACGATCCAATTCGTAGCCATCATGATGTCAGGCGTAATAGGTGTCCG
CGAACTTGGTAAACGTGTTGAATAGCGGGCTCGACAGAAAATTGTTCTTGAGACCTAGCATCGTGAAGACGTCGTCCGGGGTTTTCCCTTGGCTCATCCA
GCGTTTGTACTGCGCAGCTTCCAAGTTTGCGGCGAGGTTCCACGTGCTCGGGGTATTTCTTTCCGTCTCGAGGAGTAGCTTGGATAGTCCAACATCTCCG
TAGTGAGTCGTTAGCGTCCCTATCAAAGTGATTTCCTGGTCGGGGTTCCGCTTGTTGTGAATGTTCATGTACTTGGTGAAAGTGTTCAAAAGAGGGTTCC
CGAGAAGCTTGTCTCCAGCTTTGTCGAGTGCCAAAAACGTGAAAACGCCATCTGTAGTTTTTCCGTCGGCCATCCAGCGCTCGAACTGCTCGGTTTGCAC
TGTTTTCGCGATGGCGGAGGAACTCTTGGCCTTCAGTGCAGCTTCAACTACCCGCGACACACCCACCTCGCCGTATTGCGACGTCAGTTTCGCGAAGGCA
CTTGTCTTTTGATCAGGATGGGCCGCGTTGAAAGTCTTCAGGTACGTATTCCAAGATGCGAAGGCCGGGTTGCTGAGGATGTCGTCCCCCGCCTTGTTCA
GTTTCAAGAGTGTGAAAACATCGTCAGCGCTGTTTCCAGCCGCCAGCCAGGTCTGCATCTGCGCAGCCTCCAACTTGGTGGCCACTCCCCTCGTCCCCGT
GACCTTCTTCGCAGCGTCGAGAATCTTTACGACCGCTTCGTCACCGTAGTAAGTCGTAAGTTTAGCGATCGCCGACGTTGTCTTGCCAGGATACTTGGCG
GTGAAATCGTCCACATACGTAAGCCACGTCGTGAACTGCGGGTTGTCTAGTAGTTTATCTCCAGCCCTCGTAAGTTTCAGGCGAATAAAGACGTTGTCGA
TGGACTTCCCGTTTTTCAGCCAGGTCTGGAGTTTCTTCGTGGTGGCAGTCGAAACCAACGCTTTGGCCTTTCAATAACGAAGCTTGGGAGGCTCACTCTC
TCTTCACCGTCGTCGTCTCCGTGAAAGTGATGAAACCCACTGGCGGCGAGCTGATCGTGATTCGCGATGCGTAAACGGGCCTGAGTCAGGGAGTCCGGTT
GAATAATCTCCGATTTCTTGTGTGCGGAGGCCGTATCGGTACTGGCCAGGAGTGCGACAGCAAACAACCCAACGTAACCCAGACGCATTCTGCACCAGAC
AGAATTTTGATAAGTGAGATAGCTTCCCACGGCCGTCAAAATTGCTCTGGGTGAAGTGCAATCGCACAGTAAGCCTACATGTAGTATTATAGTACTGCAT
GTACCACGATTTTGCGTTGTTTTCGATCCTGAAAGTGCATCTCCATCTGTCTTCCAGGAGAGTCCGTCTGTCGGGATTGTGCTGTGGCTTTGCCTCTTGT
GAGGCGACCGACGCTGTTGTCAAGGTAGATCTGGGTTGGGCTGGGTGTGCTGTCGCTTGGAAAATGGTATACTGTTGAGGTCTTCGACTTGGTCCGGAGT
TTCGCTGCTGCGATAGATGACCGTATTGGTTTGACCCATTGAACTGCAAATAGTGTGTCAAGAGCGTTGTCCGTGCACTAGTTGAATTGCGGATTCTAAC
GGGGGCTGCATGTATTTTATCGGTAATAACTTAACCTGTGCCTGCTTTCGGAGCAAGAGGAAGTCTTCGGGTGATACTTAAGTAAACTATCAGTACTATT
ATATACTCGTAATGCGCAGGGGGGGTTACACAAAGCGATTTTAGAGGGAAGGCTTCTATAAAAACACATAAGCGTCAAATAGAAGGCCACTTACCACCGT
AAAAAAAGCGATTTTAGAGGGATTACGGTACGTATGAAACAAACACAATCCAATGCCTTGGGCTATACAGTTCGCGATACCAACATGAGATGGGCTTGCT
GGAGCAATCAACGAAAGCATGAGCGCCATCATGTATCGCGTGGCTTTGACTACAATGCGTGAGCGCCATCATGTATCGCGTGGCTCTAACTACGTATGTG
TGAGCGCCACTACGTATTGCGTGACTCCGACCGTGTTTCAGGTCAAAGCAAGCACAACTGCAGTCCATTCAGTTTCATAAAACGCAAGGGCTAGCCTCAC
TCTGTGCATTCACTGATTGCCAGTGACCGCTGAAAGACGGGGGGGGGGGTTAAGAACGCGCTACTGCCAGCTTTTCCCCCTTCTCAGCCGGCCGTCGGCT
TATTGGCGTTACGTAGGACGTTAACATAGCTTGTTGTATTGAAGTCAGACTCTGCGATCTTGCATATTAGCAAGGGAGAGTGATTGTTTGCCCTGCCTTA
GAAAGTACAGTGCCGATGTCAAATCTCATTTTTATCATGAGGGTTTTCCGCACTCTGAGCCTTGTCGCGCGCCCCTGAGTGGGTGTCCCTGGCTGAACCG
GCTACCCCAGTTAAGCGGGCTTCAGCAGCTTCACATGAATAGACCCTACATACTTGGTTTCACTATAGTCCACAGCGTCGCAGCGCTTATCATTGTTCGT
AGGGTCCCAAGGCCTTTGATCTTCAACGTCACAGCAGTTGAAGTCGGCCCGCAGTACGCATCCCAACATCCTCATCCGACCCAGAACAAGCTGGTCTGCC
TCTGGGTAGACCAACGCAGATGTACACGCACTCGGCGTGAGTACAAGCACCACATAGCGACTTCGGCCATGCATCGGGGAGAAGAGAAGCTTAAGAAGAG
AGCAACACAATGGGAGAGTCACAGTACGGCTGTGGCCCAAGGCTTGGCACAGCTAGAATGGAAGAGTATCCGAAGGGTGATTGGTATGGGGCCGTGGGGG
AAACATCTTCTTACGTCTTAAACTGCACGCCATTTCAACCTTTGACGCCGCAAACAGCAAGCTGGGCTGCCCGCATGAAAAATGCCGACGCCTGCACAAA
GTCACGCTGCATCACGTCTTCTGGGGTGGGTGGGGGTCAGGCGGCGGTGAAACTGCGGCAACACATGATTAGCTCATGGAGGGTACTGGGCCTACAGGAA
TCAGGCAAGGAACAAGTCATCTTCGGCTTGAAATTACACGAGATACCACGCAAACTGTGGAACTACGTGGAAGAACAAAAGAACATCGCACAAGTCCTGG
ATCTACAACTGGCGGAAGCGGTCATTGAACTGACAGAGGGCTGCTGGAGAATCGGAGTGGCGGTCTATCTTCATGCGATACAGAGGTGGAGAGCGAATCA
CTTTGATGAACTCAACAAAATGAGGGTAGGGCATCATCTTGCGACGATGTCCAACAAATTGCAGCAGGGGTACAGCACGGTAATTACTACATGAGACCTA
GTTTCGGTACGAAAGTAGGCGACGCTGCAGACAGGATAGTACGCATGGCACTTGCTAGCGCAGGCGCCACTAACCACGGCATGACAGGGGCCCCAAGACC
GGTATGCGGGTACATACGCGCACGATATTTTACTTTCTTTATTAACCGGGTCAACTTCTGGCTTAAAAGTTCTAAGCTAACTCCCCTGAGTTTTGATCTC
GGGGCAGCGCAAGGAACGTTTTTAAAAGTATTCTACCGCCCTGCAAGAGGCGCACCGAATGTCGGCTTGTTGCCTGCCGGTATTAAATTTTAGTCAACAC
CCCGTCATCGTGATGGCAGTGACGGTGACAGTCATTAGAATAAGGGCTGTGATTGAGGAACGCGGCAGTGCTTGAGAATGTACTGAGACCAAGTATGCTT
CTCTGGATTACGGACCCGCAGAGGAACACCTGGCGAGGAAACACAAAAGTATAAATCTTGGGATCTGCTCAGCGGGTAAAAACAAACTCCTCAGCACAAA
GCCAGAGGAGTAAGTGAACGGAGGATGGATTTTACTCAGACAAGAAGACGATATGCCATGGCATGGAGCGGCAGCATCAGCATCAGGTTCCCGACCCAAG
GAACTCGACAAGCCAATGCGGTGAAAATTCTGGATAATGGGCTCCAAGAACTAAAGACGCTCGGAGACGCAGCAAAAACGTACCTCCGAATCGACAGTGT
GGATAAAACAATCCAGAAGTGCCTCAGTGCAAAACCAGCGACAACACTGAACGACAGCCACATCCAGGAACTGGATCAAGAGCTACAGCGCTTCTTCGTT
GTGCAATGCAGCACACCAGCAAAAGCCGACCTGGAAGCAGTTCGGACACTGACACAAACCCACAAGACTCGACAATTTAACCTACAACAACCAAGCACAA
CAACAGACCCGATGCACAGCTACCTATCAAACTTCAAACTACAAGATCAACCAGAAGCAACACCACCCAGACAGATGAACGACATCAAGTCGCGTCTTTT
ATATTATCAAAAGACTTCTATAGAAAACACATAAACATCAAATAGAAGGCCACTTATCACCAACACCACGGGTAAAAACAAAAAAACTGAAAACAAGGGG
TTTGTGTACTGTACATTAAATTGATAAAATAAACCCAACTTGCAGTGAGCGGACCACTGTGCAACTTGCACTGCAAGTTCCATCGCCATGAACTACCTGT
TCCAAGTATGCAGCACATGTTTGATACCCCACCCCCATGCTTGATAAGAGGGTAGCCGCCAATAGCACGGCGTAGTGGACACGCATGGTGGAGCTTTACA
CGCGTTGGTACCCGAGTACTGAATTGATGATGATAATTGGCCTTTTATTTAGTGTTATGTTATTTGCCTATAGAAGCCTTGTAATATGTAAGGCGCGACT
TGATGTCTTTCGCCTGTTTTGGGGCGCGTTGCTTTTGGTCGTTTTTGCATTCCAATCGGCGAAGATATGCGAGTAGCAGAACTCGTGTGGGTCTCGTAGA
TTGTAGTTTTTTGCTGTCCGCGCTTTCGCCCATAGACGTACTGCGTCGAGGCTTGCTTTTGCTGGAGTTCCTCATTGGACGACAAAAAGCTGGTGTAGTT
CTTGGTTCATTTGTTGTTCTGGGCTGTGGTCTTCCTTTTGTTCCGTACTTCTGAATTGTTTTGTCTACACTGTCAAGTCTGAGGTACGTTTTTGCTGCAT
CCCCGTAGCTTGGAACCCTTTGTCCAGTACCGGTATACCCATCGCATTACCCGAGTGCTGAATTGCGAATTTCGAAGTGAGAAAGCGGCGCCGATCTCCA
AACAATGGACTGGTCTTTAAAGGGGCTCACGATACAAAACGGTGGCAGTGAGCGTCTATACCTGGTACCAAGCTGTGTGTGTGGGGGGGGGGGGCTGAAG
ATGGCAGCGTTTGCAATGGGCTTCTTAGAACTGCGAGCCAGGTGACTGCAAAGGCGTCCACTTGTACTGTCGCGTCCAATACTAATGGTACTCCTGGTGG
ACAGGGCTACCGGTATTGTGTTCACAACGTGCTGAAGCTGCCACGGCGACAAGCAACTCCACAGCTAGGTGCTTTCTAAGGAAGCACCAAGCCGCAAACG
CGGACGAAAGCGCTGAAGACGAGGAGAGGGGATTCGGTACCGGTATCGCCTTCATTGACGACATCATTCACAACGCTGGCACACATTGGGATGATTTTGT
GCAGAGCCATCAGCTCGACTCTATGCTGAGCGCAAGGACAAACTCTAACGATGCCTATAAATTACTAAATGTCGACAAGGTGACAGGCAACCTATTGCAA
AGCAAAGAGTGGAAAGCGTGGTCTACGTACGTGGCAATGCTCGACAAAAGCAATGCAGATGAAGCAATGGCGACGTCATTGGTGTTTCAACTCAAGCCAG
ACAAGTTGTCGAAGGTGCTGGCAGAAGCGGCGAAGAACCCGAGCACGAAGGACATTGCTGCGAGATTGGAGAGTGCGCAAGTCAAGTGGTGGGTGAGCTT
ATCCGGCACCCCAGATGATATTTTCAAGACGCTGAAGCTCAATATAGCGAGGAGCGATATTTTTGAAAGTCCGGAGCTTGCTACCTTTACCAAGTATCTT
GACGCTTTCAACAAGAAACCGCGCAACGAGCAAACAACTCTGTTCGAAGTCTTAAAGAATAGCTATGGAGATGAAGCTCTGATGAAGTTACTCGTTTCGG
CACAAAATGCCAAGAGTGAGGAGGCGACGAAAATGATGGATGACATGCTGGCGGGCTGGCTGGACTTCACCAAGTCGCCTTACAGTCTCTTCAAGTCGCT
GAACTTGGACAAGGCAGGAGATGATCTCCTCAGCAGCCCTATCTTGAGCACCTGGGTCAAGTACATGAACCAATTCAACGAGAAGCTCCCTACGAAGAAG
ACAACGATGATCGAGACGTTCATGAAGAGCTACAATGACGAAACACTGACCAAAATGCTCAATGCGGCGAAGAAGGTCCCAGCTACAGAGCAGCTCGCCA
CCAACTTGGAGAAAGCGAAGTCTGCACTGTTCAGCAAGTGGATGGTGGAAGGGATAACCCCGGCCTATCTCTTCAAGAACGTGTTGAAGCTGGATCCAGC
GACCATGGCCAGCAGTCCCAACACGAACATTTGGCGCTCGTACTACATCGCATACGACAAGGCGTACCCTGGCAAGCTGTTCTCGTTTAACCCTTAGAAT
GAAGAAGCTGATTCTTCATGTTGTTCGTTATTGAATTTTCCGAGTGCAATAGCTAGTTTACTATGATGCGCGTGCACATCATGCTCATCGGTCATTTGAA
TGAGTTTCCAGTTTAAAATCTGTGTGGGGCCCACAATGTTCGTTCACTGTCCGAAGTGTTACTATCAACGTCTTGGAAAAGATACCGAGTCTTGTTCTGG
ATGTCTCCCCATTATTGCGTCGACTGTGTCGCGCATCACTATCCCTTGGCATTCTTCGATTTACGCACCTGCGATGCAGGAATAAATCGCGGTTGCACCG
CTTAGTCATGGAGGCTGATGTTCGTCAGCAGCAGAGGGAGAAGTCCTCCTCCGTTTGACGGATCTGGTACAGTTGTTCGTCTGGCGCGAAAGGTTGCTTG
GTAGATTCGATTCGCCTGGTCGATTTTGCCGACATTGATTAGGTTCGACGAGAAACCTACCTTCGTCGATGGGGTATCGTACGTGTAGGTATGCGTTTTC
TGGGTCGTGCCCCCGGCTGCAGCTCCTCCACATAATGTCTCCCACTTTTGAGGTTTAGCAGCCAAATTCTCTGTTCTCAGTCTTGTTTGAGCAAGCTTCG
TCGACATTTACTGATGCGAACAAGCCAGTAGACTGACCCAGTTAGCGCTAGCCGTTGACTGTGCGTATCCAGGCAACAACATGTGGGTCTTTCATTTCAC
GCAAAATTGCGCGAATTCGGATTCCTCTTTTATATATTTTCATATATTTTGTCCAGCTATTGACACGTGAACTACAAACTGCAAAACAGCCCACGCCTTG
TGAACTTCAGCAGCGTAAATACATCGTTTGGAGGTTTCCCATCCTTTAGACAACACTTAATTTGCGTACATGAGCGGTTGCTGACCATTGACCAAAAGAA
AGTCAACCTATCAAAGTTCGTAGCCGAATTCTTGTCCGTTGCAGTGGCACTATAAATAAATAACGCCTACCCTTTCTTCAGTTATTCACATTCCTCATGC
ATGGTTTTAAAAAATGAAAGTCCAATGTCCAATGCAGTTACTAGAATAGCGTATTGGCGTCGAATAGTACTGCTGTTCCATAGGCACCACCATCTAACGT
ATGTTTAACGGTTTAAGCAACGTTTCCCTACACTGCGTTGGCTTTCTTAATGTATCGCTCGATCATTTCATCAGCGGCAACAACACCACTGAGCATATTG
GAAAGTTTTGCTGGACTTCCTTCGCACGCAGCCACTTGTTCAGCAGTGCGTTCTGCAAGTCTATGACCAGCTTTTCTGTTCTCGAAGCTTTCTTCGCCGC
ATCGAACATCTCCAACAGGGATCGATAGTTGTAGGTGACGCTCAAACTATCGAACATAGTCGTTTTTTGTCGGGATATCGCAGGTTAAAGTCACCCAGAT
ACTTAGTCCAAGTTTCAAAACGAGGATTAGCAAGAACGTTTCCATCTGCCTTGGAAAAATGTAGAATCCATTTGAAAGTAAGATATGGCGGCAGCTGCTC
GTTGACGAGCCAACGCTTCAATTGTTTCGCCTGTACCATTTCAGCGACTTTCACAGTGTCTGGATTTCGCAGCCCCTTGTTAATCATCGCTTCAACACCA
AACTCCGTATAGGCCTTACGCAGTGCAAAGTACCAATCCGTTTTCTTTGCTGGGTTCTCTCGGTCGAACTTCTTCACGTAGTCGAGCCAAATCTTGAACA
GCGGATTGCCAAGAACATTATCCCATGCATCGCCGAGCCCGAGCAGGTTGAAGATTTCATCGGGAGATTCCTTGCTGGCGAGATGGCTCTGGATCTTCTC
CGTCTGCAATTTGCTAGCAGTGCTTTCTAGATGCGGGTATTTCTTCGCCTCCTCGAGGATTTTGATCAGTCGTTTGTCGTTGTAGTGGGTCGTCAAAGTC
TTGAACAAGTTCGTTTCCTCCCTCGGATGTTTGTTGTTGTAGACGTTCATGTACGAGCTCCACGTCTTATACAGCGGATTGTCGAAGAAGTTCTTCTCTG
CTTTGTCAAGTTTCAGCAGCGTGAAGACGTCGTCCGATGATTTACCACTAGTCAGCCAGACTTGCATCTGTTGGGTCTCCAACTTTGTCGCCACTGCCTT
CGTACTGTCAAGTGTCTTTCCGAAAGCAATAATCTTTGCCAGAGGTTCATCCTCGAACCTCTTCGTCAAAACATGAAACAGAGTTGTTTCCTTCGCTGAG
TACTGCGCATTGAAATCATCCAGGTACTTGACCCACGTGCTGAAAAGCGGACTCGCCATCAGATTATCCTCTACGTTGCCAAGTCCCAACTGAACGAACG
CATTGTCTGGTGTTTTCCCACTCTTCAGCCATCCCTGAAGCTGCTGGGCCTCCAACTTGGTGGCGATGCTCTTTGTTGCGTCCAACTTCTTCTGTATCAA
GCATCTTGAACAGAATATCATACAGCATGATCTGGCTGACCTCAACGACCGAGGATCGGCCATAGCTCGTGATCACAACGCTATGATGATCGAGAGGGTC
GTCGCCCTTCAGCACTTAGCGATCGTAACCACTGCGGTTGGTGCGTCGCCCCACGTCTTGCGAACGTGCAAGAGACTCTGGCCCCTCATTCCCGGAGCAC
CATTTATCTGCCGAAGGTGACGTTCCGATCAGGGCATCCCTCACGCAGATCGGGGTTCCGATCTGGGCGAGCCGGATTCAGTCCCTCAGGGCAGTCAACC
CGATCCTGAGCATAGCGGGAACGGATCTCCGCTTCATGACCTGCCTGTGACGTCAGGCACCTTGGATCTGGACAGCGGCTCCGGTGGTCTACCGAGTGAC
CTCCCAGGGTCTCCGGATCCTGCCTCACCCAAACATCAGCGTAGCCGGTCCCCTTCATTCGGGTCTTCACCTCATCGCCCCCACAAGAAGGCTCATCCCG
TCGAGATTGACGATGACGACGGTCAGGAGGGCGCCCTCGACATTGATGACGATGGGGGCCAAGATCAAGCATTTTCGGACCCCGGTTCTGGAGATCCAGA
ACATCCTCGTGAGGACGGATCCGAGCATAGCAACGGGTCCGGTCGGCGTCGTTCTCGATCTTCGTTGTCCGAAATGTCGGATGATGCTGAAGAGCGATGA
CGAGGAAGCCTCCGCTGATGCTGAGGACGCTGAAGAGGCCTTCAATCAAGACACCTTGCGCGCTCTGGCTCAGTCCCGATCTGAAGATCGCCGCCACAAA
CACGTAACACCCCCTCGTCGATCGTTGCTCCAACAAGGCGCTGGCAGATCGGGAGATCCGTCTGGATCTCCTGCCGGATCGGATCATGGAGGTGGATCCC
CACGTCAAGACGCTACTTCCCCTCTGATCCCAGCTTCCAGCCAACACCACCTACCTGCGGCTCCGTTCGGACCGATGCGATCTGCATCCGGGACGTTCGA
GCGTCGAGTGATGTACATACAGGATGTGGAGCCTTGGATCGTCCGCATTCTTAACCAGAGCACGATCATGGACATCACGATTGCTGTGCTGTTCCTCACT
CTCCCGAACCGACCGGGTGGATGTTCCCTACGGACGATACTGCGATGCCGCCGCTGCGAGAAGACCAATACTGCGAAGAGCTGATCAGCGAGCAGAACGT
GCGAGATCCGTGGCGACTCGTCCCTGGAGGTCTTGGGAAACGCTGGCCAGGCTATCACCTTCGATCCAGCTGCTGCCGGCGCTTGGGACAGTTGGCCCGA
GAGTATTTAGTCCACGAGACTCGCGATCTGCAGACTTACTGGGAGAGCACACACTCTTTCCCGATCTCGAAGGCTAAGTGTTCGGCCAACCCGTGGTTGG
CTCGCTATCGCACGAGTCCTAGTAATCGGCGCGGTCACGCGGGAACTCGCTGGAAGCATGTACGCTAGCTCCTGATCTTGGCTATGCGGATGGTGGTGTG
ATCTAGATGTTCTACTGGACATTTACTTCCTTCACTTCCCCACCAGATCGAGAAGGTCACGTGGTACCTGGGGTCGTTTCACGCCTCGCGAAGCTGGCTA
ATCCTCTTATATCACAGGACGAGCCGACAACGCTCCTGGAGACTCTCGATGAATGCAACGAGGCAGATCCTTGGCGCAATCATTTTCGTGACTCTCCTCA
AGATCACCCGGCGTACCGCCTTACCCGCGTCGCGGGCAAATTCCTCAGTGTGCATCCTGCTACACCAGCTACTCCGTGATTCCTGAAGCGCGCCAGCTCA
GGTAGTTCTTCCGTCTCTTGATTAGCCACTCCTTCATATTGCTTTCCCAATTCACCGATTTCAGATCCCGATCCGGGGCTGTCACCACTTATTCTTCGTC
GATTGCATACTCATATGTTTACATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACC
AACGGGTCCCGCCTCACTATCCCTCGTGAGACTGCATCAAACCAAATCGGTTGTGATTCACGCGATCCCGTAGGAACTCATACAATAACGCACCACAGTT
GAGATCCGCTTCGTCGATCCGCTGGGCTCCTCATATCCACGCCAGTGTACTAGGAACTCACGATAGATCCGTCCATATCTCGTACGCTAGCCGGATCTCA
GATCCGTGATCTTCTCGACTTTGTATTCATCGGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCGCA
ACCAACTGAACGAGCGGGCGATCTGGGAACTCCTTCACCAACTTCAACTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGACAGTTTCGA
GCTTGACCGCGTACTCATGGATTTTCTCTGCCACTCGAAATGGCCCGCGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGCG
AGATCCAGCTTCTATCGGGTGAGGTCGAACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACC
CGCGTATAATAACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGAGTACTACCCACCGGGATCCTGGCCTCTAATGTAGATCTAG
GATCCCACCCATGTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCCTGGGCTGTGTTAAGGGCAAACGTAAGTCGCTCGGCGTACTCGTCCCAATC
CTGTTGATCCAGATCATGGACATGCATCTTGAGTGCGCGCGTGATCGTCTGAACCATGCGCGCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTG
GCCCTCTGACGCTGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGCTCCCGATCGTGCCGAATTACCTCGCTAGCGCCAAATC
GGCGGAACACACATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGAT
CAGCAACTCCGTGTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGAC
TCGCCTCGGATAGTTGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGAT
CTCGGATCCGCTGGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAAC
CAACCGCATCGCGAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGCGTAATCCGTCCATCTCGTAATCCATTGCCAGATTGCTGTAG
GATCGAGCTTCTTCCTGGGCCAACGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCT
CTATCCTGAGCTCCCTCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAATCGGACCACGGATT
CTCGGACTGTGACGGTTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCATCTCGCTGAAGGGCAG
CTCCGGCGAGGCTGTCAGCGGAACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAA
CAGAACCAAACCTGGGGCCTTACAATCAATTTCCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGC
CAGGAGGTCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATCTGGTA
GTTTCCACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGG
TACGGGAGCTTGGATCTGCCGTCGGGGTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTCCACATCGGACTAGGTGTAATACTGGCAGCCATCGCCCCT
AGGATTTCGTCTTCACCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATC
GGAACAACCATGCTAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACAC
TTCCTTCTCGACCACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCG
GCGGAAATAGCCCATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACG
CTGCAAACGACCTATATGCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGG
TTCAGACGAACTGTGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATC
GCATAGTCCTCGATAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCA
AGTCCTTCGGATTAGCTTCGATGCCATCGTCGGACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGG
TTCCATTTATCACACGCTTCGAGCAGATTCTCCACCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCC
TAACACTGACGGACGACCTGGATCTTCCGGTTCTCCAGCCTCAAAGATCTGGAGCAAGTCCTGGCTCCTCAGGGGGGGGATCCGTGTAAACCCATATAAC
GCATTATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGA
TCGCGCGAGCTCGGTCCGTCATAGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATT
GATCAGAGGCATAGGGTAGATCATTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTTGATGATCACC
ACGATCGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTA
TCTTCCGCACCCGTTGCACGATCGGCTTAGCACCTCCTACATCGATATCACATACGACTCCTCGAGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAA
CAAGTGTCGCTTCCGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCG
CTCGTCATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGTGATAAATATGTCCATCTTCCG
GCGGCTCCGCGACCTGTTTTTGGTTCAGTTCCGACTCCACCACCGGAATCGACCGATCTGGATCTGGATCTTCGTATCGTTTTTGGCCGGTACTTGATGT
GTCCAGTCGATCTGGATCTGGATCTTCGTGCCGTCTCTGGCCGACACTTGATGTGTCCAGCTGATCTGTCGGGATGGGCGCCGTCGGATCGGCACAATCG
CTGGAAACGCAACCAGACGGGACATTCCGCATCTGATCGGTTTCGGCTGGGATCTCGACGTCCTGTTGCTCCGGCAGTTTTGGTAGGGCAGGTAAACCAT
GTCGATCGGTTCGGCACTCAGGATCCGGTTGATCGGCGGGATTGCGTCTACCTTGATCTTGGCCATCCACGCCTAGTTCTGCGTCCACACCAATTATCCT
GAACTCCTCCTCTTGAGATGGGTCAGCGGTTAGAGCCGGATCAGGGTACTTTGGTCTTGATCTGGCCTTTCCGATGATGGCTCCGTTGCATGCTCTGCAC
CTGGGCCTTCTTGATCATGTCCTGCCGCTATATCCTGGGCAATCTCCACTCCTTCCTGCGATCTTACAACATCCGGATCCGAGTCTCCAGTGGCGGGCTT
GCTCAGATCAAGAGTGATCTGGGCGATCGGGTTCCTGCGAAGTATCGCTCGTGGGGTCACATATGTTGGACGCTCCACGGCGGGCCCCTGATCGAGTTCC
GGTGAATTTGCTTGCGTCGGTTTCGACTCCACGGTAGATTCGAGTACTAGATTCTGCCACTCCATGTAGCGACGAGATCCGACCGAAACGAAACCTGGCA
GGCGGGGAACGCGGTCTCCAGCCAGCCACATGCCGACCTTCTCATCGCCTTGTAGAATTAGGACCTTTTCACTGATGTTGGTGATCTGCAAGTACCGTGT
CCTTCCTGGTCCTTTGACCACGGTCGGAACCCAGCGATCTCCGCGAGTGATCCATAGCTTCTCTCGATCGGACAGTCGCAGTCGTATAGGCAGCTCCACT
GTTTCTCCCACTCCGATCTGCATGTGCTGATCCAGCCGTAGCATCTTCACCTTGTCATTATAGAGCTGGCGTCGTCCGCTAAGCTGGATCTGGACCTCAT
CTGGCAGACAAATGGATCCGTCGGCCAGATCTAGTCTGATCCCGGCTGGGACCATGAAATCCATGCCTAGAATAGCTTCCTGTCCGGACTAATCTCCAAC
CCAGATGTCGAAAAAATACACGAACACTCCGGCTAACGTGATCTTGATCCGGGTTCTCCCCTCCGTAGTGTATACGTTCTCGCCAATTCCAACACATTCT
TGGCTCTGACTCGTGTCGATATAGCACCCAACCTTACGAGCAAAGGTGGTGTCCACAATGGACACCTCGGCACCTGTATCTAGGAGTAAGATCGCCTTTT
CATTGTTGATCTTGCCAGTCAGCTTCGCTTGGCGAAACCATTTCCCCGGCGCATGGTGTTTCCAATACCCCCTCGACTCCCCGGGTAGGAGGTCCATAGA
GGGTCTGGCGCCAGATCTGCGGAATTCACTGACGTGGGGTAGATCCAGATCTGAGGTCGCAGTGACAGCTTCTCCATCGGTTGGTCGAAACCATTCCTCT
TGGTCACGCTGGCCCCAATATCCGCGAAATTCCCAGACTGTAGATCTAGCGACACTTCAACCTCCGATCGGTCAAATTCATCTGATCGCAGGCTGGAGAT
CTTGGCAACTTGTTCCTCGTGCAGATCACATGTATTACCGCATAGATCTGGTCGTTGACTACCTTGATCTAGCGATAGCTTGTTCACAAATGCATAAATG
CAATACCTAGAACGCTCGGCTCGTATCGGTTTCCAAACCGACGAGCGTCCTAGTTTAACATCTTCTCTGCCATCGCTGGTAACATCCCGGCATGCTTGGT
CGAGTTGTACCACTGGCGGATCTGATTGTAGATCTCCTCCATCGGACATTTGCCCATATCATGAAGCTCGCCACATCCACGGCAGACAAACAGGCAGTGA
TCCGCTGGGTGTCCTCGCTTGCCACGTAAGGCGTCTCCAACAGCCGAGATCCGTATGCTTACGGGATCCACAATGCGAGCACTGGTTGTGATCTGATCCG
TCGAATCTATCTTGAGATCTTGGATCACGTGGTGATTTCTCCGGCGAATTCGAATTCGTCCGGAGTGGGTCTGTCGGGGGCGGGGCATTCGTCACTTCGC
GTGACTTCTCCTCGCCCGAAGCCAAGTAGATCCGGCGCAGATCGCCTTCTGCATCCGATCCATCCGATCTGAGCCCTGGATCTGGATCGCATGTACCGCT
CGCTTAGCTGGAGCTGCCGAAGCTGTCGCTGCCGCCTTCTGTCGGTATTTCGACCCAAATGCTGACCGCTTCTGCCGGATTTTCGCATGTTCCCTCGCTC
GGAGGACTTCTTCTAGTGCGTCGGTATCTGGGAGCCGTAGTAGCGTCAATTGATCAGCCAGATCTTGATCTCCGAGGGTCTCGACAAAGTGATCCACATG
TTCCCGGCGATCTTTCGGTTCCCCGTCCTTGATCTTGAGGCGGGTACGTAGAGCAGCAACGTTCAGACGGTGGAGATACTCTAATGGTGATTCATCCGAC
CGCTTACGTGCGTGATAATACTGCCAGGCAACCGAAACACCTAATCCACAGTATTGCACCTGGAAGCAGCGCAGCAGATCACTCCATTTGGTCCGAGTAA
GTTCGGCTTAGCTGGCGGTACCAATTCTTGGCTGGGCCAGCGAGTAGATCTGCAAAGGTCAGACACTTCTCTTCATCCGAAGCTTGGTCTCGGAGAAATG
CTGACTTGACCTTGCTGATCCAAGATCGAGCGCGATCTTCATCCTGATCTTTACCCAAGAATTCCTTCAGATCCGAGATCGCCGAGATCCGAACCCTCTG
AATCATGGAAGTTCCATTGGATCCGGCGGCTGCGGTGGCCACGGTGACCCGTCCTGAGCGTGGAGCTTCGAGATCGTCGGGATCATAATCCCATGGTGAG
GGATGGTGGGATCCGACTGACTCCATGTCCACATCTTCGTACTTAGGTTCCGCGGGCACTCGAGGTGGATTGATCACCTGTTGTTCCTTGAGGAAGCGAC
TCATCGCAGCTTGGAAGTAGGATTCCAAACTGCTTGTCGTTGGATCTGTCGCAGAGGTGATCGGGATCGTAGCTGCGGGCATCGTTGGTTTTGTCCATGG
GCTTTGCGCTGCGATCGTGGCCACGGGCATCCTTGGCTCATTTCGCGAACGTGGTTTTGAGATCGGGATCGCCGACGTGGCCGGCTGGTCCCGCGGATCT
AGTGGTTTTATATCCGCCACCTTCGCGCGGGATCCGATCAGGGCCATTCCGGATGGGCCCAGAGGCATACGTCGTGGATCTGCAGAGCTGTCCGAGTCTG
GCTCCGAAGTAGCTGATGCGTAGTGCGAAGATCCAGTCTGGCACTCTGCAGTGCTGACCTGAGGCGATGGCTCGGGATCTTGGATCTGAGGGCTTTCGCC
TACCAGAAGCTTCAGGCAATCAAAGAGGCCTCGGTTCGCATAGTGAATAGTGTCTAGATCCAGATCGAACAGTTCGTTCGCTTCGAACGATCCTGCCACC
AAGCCTGAGTCGTTCAGCAAACGAAACTGCTCCTTCACAGCGTTCAGCTTGTTGGAGAGGACTCGTGGTACTGACACCGGTCCTTTCAGAACTCTGATCT
GCTTCGGGATCAGGATCTTCATCATCGGATCCCGGCGTAAGAACTCACCTAGGTTCTTGCGATGATACGCATATTCCAGTGAGTCTTCGTTCCATAGTAG
CGCAGATGCACCACGATCTTCGACATCCGACTCTGGAGCTTTCAGTTTCTTCCTCGCAGCCTTGCTCTTTTTCTTCTTCGTGGTGGATCTTGGCGCTGGC
GGGTTTGTGAACGAATATGGTTCAGGCTTTGCCTTTACCTCATCGTTCGGCAAATCTCGATGCGAATCGATATCTGCGGGGGTCCCCCAAGGGACCTGGG
GAGGAAATCGAGGTTTTTCTTCTAGATCCGGATCCGGATCTCCCTCTTCTTGTCTGTCGTCAGAGCTCCTCCCAGGGCTCTGTCGATCTGCGGATCTTGC
TTCATTCAGCAGCGTCGTCGATCCGATCTCCGATGACGCTTGGTCCCCTGGTTCTTTCTTCACTTGAACATCTTCTTCTGCGAACTCACGGTGAAATCCT
GAGTCGCCAAGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCCGTCAAAATCTGGTTAAGACTGGATCCGGCTTCCCAACTGCCCAGATACCA
ACTAACGGAGGGGGTCCCCCGATGATCCGTGATCTGCTGAACTTCTCACCTTGTGTACCCGTTGGTGGGCTGGATCTGCTCTCTCGGCGCTCCGAAGAGA
TGTGGCTATGTGTTTCTTGACCGTCCTGGCGGGACGCGGGGATGGGGTGGAGCAGCGCGGAAGTCTTCGCTCTGCTGCCGGTTATGGATCCAGATCCAGA
GCGATTCAATCAAGCTCTGATCTGGCGGCCTGGACTTGATCTGGGGCCGGGGTTGCCTTTGGGGTGTGGATGCCTCCTTCCTTTGCGTTACTTGCCTCTT
CCTGTAGCGGGGGCTCTGGGGTTTGATAAATCGAGAGAACTTCGGGCCAAGTAATAACTCCGTCGGATCTGAGATCTGCACTTGATAGTAGATCACTAGA
GTAGGTAAAATCTGGCCAATATATTATCCAGACTTACACAACCACTAGATCAGCTACTCCTTGTCTTGCCAACACCTTGTAGGGCCAATGTAGTTCCCGT
TTCTTGGCGGAGGCGAAGCACTCTTGTAGTTCAGGGCAAATTCGATTCTGATTTATGGTTAAGTCCTATCACATCCTTGATCCTATCCTGCATCCACTCA
TCCACGGTGTACGACCGATGCGTCTTTTCTACCATCTCCCATCCTTTCCGTCGTCATCTGTACGGGGTACCTTGATGTAATCACCTGATTGCGATACCTC
ACTATCCCATGCTCCACTATTGGGCAGGATCCGAGATCAAGATGCGGGATCCGCCTACGCCTTAGTACCGGGCCAGATCATGATCTAGATGGAACCTGAG
ATCAAGATCCGGGATCCGCCCTGCCTTGTGTCGAGCCAGATCGTGATCCGGGCGAACTTTACTGTGGGGCCAGATCCTGATCTGGCCAGCTTCAGTCCCC
AAGATTTCCCCATCTCGGCGATGCTTGATCTAGGTGCGCCGTCACTTCCTCAATCTGTGCATCGCCCTCGTTGACCTGGCATCGCTTTCCTTAACGATTC
TTCCACGAACCGCGGTGTACCTTGAGTACACTTAGATCTTTGTCTCGACCTTGGTACAGCTACGCCTCTGGATCACCCGCCGGATCTGGCACCCATGGCG
GGACCCATTACTCGCCTCGTCCTTTCTGGTCCTTTTCTCGGCGGCATCGCCATCTTAGTCCGGATCCATCCAACTGTCATTGTCTCGGGACTGTGACCTC
TGCATTTCATTTCCGATCGCATTTTCTGGAAGGTACTTCACCACACAACTGTTCACGTCGCAGTACTTCACAGACTGCATGTAAGTGCGCCACATGCTCT
TCCATACTTTTCGAGAAGACGCATATGTCGTCGAGATACACGACAACAAACTCAAATTTATCGAACAACGTGTGCATTAAATGAGACCATGTTCCAGGCA
TGCCTGCCACTCCCATAGGCGCAACACACCACTGGTCCGTTTCTTTGTGCGTTCGAAACGCTGTGTACGGTCGACTTGACTTTACCACCCTCATCTGATG
ATATCCCTGCGCTAAGGCGATCAACGTGTAGATGACACAACCTACCATCTTATCGAACAGTTCTTCGATTAGAGGCAACGGAATCTTGGCGATAACAGTT
ACACTGTTGAGATAGCGGTACACCGTAATGGAAATTGCTGATTTCCGCTACATAACCACTCAGCTCTCTTAGGCATCTTTCCCGTGACTGGGTCCTTCTT
CGAAATTGCGAAGATATTCGAAACCCATGATGAGTTCGAAACTTCGATCCAACCCTTTCGCAACGTGTCCTTGACGAATTCCTCAAAAGCCTCTTGTTCC
ATTTTCGACATCCGGAACGGAGCTCGAGTACTCGGTTGCGCTTCCTTCTTCAGCGTGAGCTCGAAATTAACTTCACGCATTGGAGGCAATCCATCCGGCA
ACTGGTCAGGAAACACATCCTTGAACTCTTCTGCTACAACGTTCCTTATCGGCTCGGGAACTGCTTCCAGCTCAGGCACGATTTATTGCTTCACTCGGTA
TACCTGTTCATACTCGCCTGCGTGTAACGCATGCGTGAACGTAGTTCCATCGACGTCTGCAAACTGTATATGTTCTGGTATTACTCTGCCAGTTCACTTG
TGCATTGAACTCTTCAAACCACGGTTTCCCCAAAACGACGTCGTGCGACTCTAATAGTTTTCATTCAACGAACTACATCGTTGGAAAAAAATAACCGTCC
ATGCTCACCGGCGCTTCAACGTGCTTGACATCCGTTGGTGAAGTCAGCTTCCCATCAAAGCGTTGAGCCTGCAAGCGTCTAGACACCAATACGATGCTCG
CCAATCCTGGCTTAATCATGTTCGTACTTGCACCCGTGTCCAACAGAATTCGGACATATTTGCCATTGATGCGACCCTTCTTAATGAAAAGGTTGCTCTT
ACGTTCGGACACCTCTGCATTGACGCTTACGTCGGTCTGTACACTTGACGTTGGTCGCGAATCCTGCTGAACCACGTCGACTTCTGGATGCGTCGCATGC
TATTCAGACTTCTGCTCTGGTGGCGATGCGCACTCACCAGACTCCTCTTCTGAAGGCATCGCATGCAATTCAGGTTTCTGCTTTGGCGGCTATCCGCACT
CACCAGGCTCTTCTGTCGTTTCCGACACTGCAGTGAAAGTCTTTTCCACTTCCTTACGCGTCTGTTCGATGAAGGCTTGCAGCGCATCCGCTTGCTCCTG
GATGTCTGCAACGTTCATCGTCACGCGGTCCATGATGACAGTGTTCATCTTACCGTCATCGTCTTCGCGAAACATGTTGATTCGCGTGATACCCCCTCTT
TGCGCATGCAAACCCGCGTTAGTGTACTTCGGCGCGCTACGTTTTGCGTTTTGCGTCTGCATCAGCTGTACAGGACAGTCCCTGGCCCGATGAGCAGAGC
TACCACATCGGAAGCACAAATTTCGGCGCATACAATCCTCCTTCGAAAGCACCCTCACGTTGTCGATCTCCATCTTTTTGCTTGTTTCTGTTTCTTTCGT
GCCTTTGCTGCTACCCTGCATGTTTTTTTTTCTCTTTTTTCTGTGGCACTTCTTGCTTATCTACATAAATGCATATTCACTGTTACTATATGCATGGTCA
CTGTGACTGCTGGCCCATCAAGACAGCCGTCACACTGATAAGTGCTTCTGGGTGCTTAGCAAGCATGACAGAGCCTTTGCGCCCATGCGCTCTGGCCTGC
TTGCTAAGCAGCCAGACGCGGGCATGACAGGAGGCCAATGTGACGGCTGCTGCGAGTGAAGCGACAGCCAATGGCGTCGCGTTGCCTGAAGGAATAGACA
ACAGTGGGCTCTGAGACGCGGTAGTAGTACCTTGCTCCCAATGGTTATGTGTCTGCGCTGCCGGACCTTGTGAGTATTGCTTGGCTACAGCAGCTCGCAC
CACGGGAGCAAAAGAGCAAGGATAGAGTAAATGGCTACGTCTAGACAGTCATGAGAAGAGCGCTGGTGGCACAGGTGGAAATCTACGACCCACTGAGTGT
CTCCCAGACACTGGCTTGCAAGGATGCTGTCGTGAGTCTGGCGAATGAGGTTCCAGAACGCTGTCAACGTCGATGTACCACGTGAGTATAGGCCTCAGAA
TCATTTCTGTTTTGAGTGGCGATGCCTAAGCGCAGCGCACTTATTCTCTCGGTAAGTGGGGATATCGGGGACACACAGTTTTCCGGAGAAGGTAGCTTGG
TGGCAACCAACTTGGGGCAGCAACAACTGGTCTACCAAGCCGAAGCCTTAATAATTGCTAAACACTGTGCAGGATACCAAACCTCCGGATACCACGAATC
TGTTACTTCGACGCTTCTTGACCAATTCGAGTTGACTTGAGTGTTGAAGAAGATGTCCTCGGCGAATGTGCAACTGTAAGTGTTCGGTTTCCGCCGGCGA
AGATGTCGAAGACGTCGCCAGCCAAAAGAGGAAAACTGTCTTTTTTGATCGAGAGGAGTTGAGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCT
AGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGGAACCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTTAT
AGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAAACAAGTGCCTAATGGTTGTCTCACCGCCAACCGGTACCACGTACCA
TGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGGTACACGTTGGTGTACCCCGTTACATCCTCCCCCATTTATCTGAGTATCACATCTT
ATTCTCCAATTAGAAGGGAGAGAATTGGAACTCCCAAATTGGGAATTCCCGGGCGCAGCCACAGCACGGCTGGCGCGCCCTCTCGACAGTCACGCAGTGA
CTTGTGTCCGTGGCGGACACTGCGTGGTGCTTCCTTGCACAAAGAACGATGTCGGCCGCGAACCCGACGTCCTTAGCAACTCGCGTTGCAGCGCTAGCAA
GCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTCGTTGACCACCGGCAGTTCACTTGGGAGGAGCCGTGCCCCACCCTGA
CACTTCGTGTGTCTTGTGTCTCCCGTGTGGGTCGACACCATCCCGGGCATCACATAGCCCAAGAGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATTATA
GCGGACCCGCATGGCCCACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGTGCCGTACACGCGCTCTGGTCATTCGTTGACCAAAGCACTAAGCATCGTG
CTTCGTCGTAGTGATACGACGGTTGCCATTAGCAGCCTGCTCATCACCAAAAGCATTTCGGGTAGAGCAGCAAGCTTCACCCCGCGTCTAGGTCGTCGTA
CCAAAGACGCTTCGGTGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCATGGTGGAGAGTTACATGCACTCTCTACCACCTTGACTCTGGTG
CCAGCGATTGCTTCGTGCATCGCCAAGACCAAGACACGGTCGGAGTGTGTGCAAGCCTGCACGACACTCGGTCTTTTTCATGACCACGACGGTGTACGGG
CCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTACCACTAGAACATTGAGATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCA
CATGTGACCGCGTCGGCGTACAGGGCTGTGCTCCCGTACGCCAGAGGTACGCCGTGTGCTCAATGTACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGC
ACTGATTCTGTACAGTTGTTGGTTCATGCCAACAACAGCTTCCGTGAGGATGCTAGTCTCCCTAGAGACTTGGGAGGAGAGGTATTTCCGAACCCCTCCC
CCTCTTACGATCGATCCCCCTCCGGGGTGACCGAGTCGATCGCGGCTGGAATTCTTCCAGCCCGGGAACAGTTTGAGTCTGTGCGACTTGACGTGGGAAC
GAATACCCACGTCGGGTGAAGCCACCATGGGCTCACCTGGTGTGTGGAACTATGTTAC