Description :
From Genome Similarity Track
Location :
Scaffold_1486:548- 2646
Sequence
2098 bases(100 bases per row)
AAGATGCCAAATGCAACCTTTTTGCTTAATCTGTTTAACTACAACGACGAATAACAGTCCCTGCCCTTTATGGGTCAGGGCGGGCATTTATGGTCAGGCG
GCATCCCAAACATGAAGTCCAAACTGACCGACTTCCCAAAAATCAGTTGGTATCGGTAGTGGCTTCAGTGGTGCACTAGTAGAAGGTGCAGGCTTTACAC
GCTGACTCACTTCGTATGATCGAATATCATTGGCTACCCATCTATATAGGTGTGCCCACCAAATTCATTGGACACTCGTAAGAATGTCTTGTCACAGCCC
AGATGACCACTTGATGGTGCATTATGGATCTCGTATAAAATCTCCTGTTTCAGGTCTGTGTCATGGGGAACATGAATTCTCAATGGATCACATAGTGACA
GTTGATTCCATAACAGGCCATCACTATAACTATAGCGGTAATCTTTGGCTTGAGGTGCGACGAAAGATTAAGTTTTCGTCTATCTAAGTGATACATAAGC
AGACGACAATATTTGTCCTGCATGTAGCTCTCCTTTGTATCAGAACCCTGAGTGTTTTTTACATGGTGAACACGTCAGGCTGGCAGTGTTGACGACTCAA
CTCGTGCTTTGGCACGAGATACGGATTCAAGTTGTCGTTCGTCGAAGTCTGGTCTGCGCGATAACGCTTCCGGACATTCAACTTCCCCGGGTTGTATTCA
ACTAGAAAATTAATTTCTGAGAAAAGTGTGAGCCACCAGGACATCCTAGAAAAAGACGCGGTGTGTTTATCGCGGTCGGCAATGATGCGTGATCCGTGTA
AACCACAAAAGGTTCGGTGCCCAAATGGTCCATTCGAAACTTAACAAGAGCATAATTTATAGAAAGTAGCGCCTTGTCGTGCACGGGGTAATTCAGCTCC
GCGGCCTATAATAGTCGGGACTGATACGAGATGACACGGTCAATACCATCTTCATCCTTTTGCATAAGTGAACTGCTGATAGCGAGATTACTCGCACCGC
AGACAACACTATAGGGCTTATTCGCGTCTGGCAAAGCCAAGACTGGAGGCTCTACAAGTGACTGCTTCACTGAAGTGAAATCATCTACTTAAGCCTCAGA
TCAAGTCCTCTCTGCGCCTTTTTCAAGAGGTCAGACATTAGTTGGTTCGCTCTGCATAATTCTTGCTATATTTGTGCATGTAATTATCAAGCTCAAGGAA
TTGACGCAGATCCTTCACAAGGTCGTGGGATTGGACATTCCTTGATAGCTTTTACCTTATTTGGGTCTTCTCGCCAAGTTGACGTTCAATTTGGCGTCTT
CCAGAGTTTGTAACACAACGTCCAAATGGCGTTTGTGCAATTCAATCTCACTCAACCCGTCCTAGCCCCTACTATGAAGGAGCAAATTGTCTTAGCAATG
AGACGCGTAGGCACGATGCGGACGCATCACATGAGCGGCCACCCATTAGACGTCGCTGATGCATTTTTTTAACCCTTGCGGTAATAATGGCTACTCCCAC
AGCATACCGCTTGGGGTGCCAACTGCCGTCTTGGCTACATAGATCTGATTCACGAGTACGCGATAGTAGCCATCCTTCAAACTTAATGCGGAAAAGACAG
TTGACATCCCCATTAAGTTCAATAGAACATCTTTCCGCGGGATCGGTATTCGCGCTGGAATGGTTGCCGTGTTCAACTTACTGTAAGCATGAACTTCGCT
CTGGTTCCAAAGGAGAACTTTGTGGACTGTTGCTCTTCGTCCACAATGGACGAGAGTGTCTTGGAGATCGACAAGACAAAACGATTTGCTACATAAGGCT
GGAAGGCTTTGAAACGCAGTCCGTTTTAAGAAGTTCTGTGGAAGCACTGTGTCTCTCATGTACACGTCCTGCCTTGGCTCTCTATTCGAAATACTGGTCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATGGCTACTATCGCGTACTCGTGAATCAGATCTA