Description :
From Genome Similarity Track
Location :
Scaffold_2082:548- 2367
Transcript NameFunction/comments
Phypl_g14650hypothetical protein

Sequence
1819 bases(100 bases per row)
AGCGAGGTTCATTTGGCGGCATCTGGAGACAACAGGAACCGGTGTCAGCTGGTGTGGTTGACATACGTCTGGACCCACAGCGTAACCTCAGTAAAAAGCC
AAGACAAGGGATTGCAAGGCGCGCGTACACACGCCACGCCCAGACTTGCCAAGCCCGGACTTGCTAGGCTGGGACTTTCGGGTCTCAGTGAAGAAGGTCT
GAGTTTAGCGGGTTTGAGCAGTCTAATTTCAAGGTCCTACTTCCTGTGACTTCTGCATTTTGGGTAACGCGCCTCGCCACACATCGGCCATATTGAACCA
CCTAGTGATCTACCCTCAAGTGAAGTTCCAAGATCGACCCGAGTTCATAGCTTGGATGGGAGATCCTTCAGCTCTCAACTATCAAGGTCCCGCTACACGG
ACTGATCCAACTCCAGGCTGCCAGATCCAAGTCCAATTCATAAAGTCACCAAATCAGCGCGATCACAAAGCAtccggggggggggctccgttagtcggtg
tTTGGGCTCAGTGTGAAGTCAGATCCAGCGTTAACTTGATGTCGCAGAGAGAAAGCAACTAAAGCAACGGACTCAACAACGGTCTCGCGTGGTGCCTCCG
TCACGCGCCCACTTCGTAATCCACAatgccgacgacgagtgAGTCCGGTGCCGCACATTTATGCTATTCGGCGTACTTCGTGATGGAGAGAGACCTCAAG
TCGTGGGCACTGTACAACCTCGACGGTGCTGAAGAACCCGAGCGCCTTGACACCATGGAATAATACTTCAGGCGCTATCGCGCGATCCGGGGCAAGGCAA
CCATCCACACGTACACACGATGCTCTGCAGCGGCCATGATGCGCCTTTATTCCCCGGTGGAACGCCGCTCGCTGTGAAGGTCTCTATGTCGCACCTTGgc
tcgaggtcgaggaccGGGAAGCCACGCAGGGCGCGCATGCTATTGGGGACCCTCGTGCGCGCATGTGCGAACTGGCACAGCGCGAGTGGAGCCGGACTAC
GTGCACATGGTTGAAGGCTGCCGAAACTTTAACAAAACCTAAGCCCGACACGTGAGGAGTGGGATCGGCAATTGACACAGTGACCGCTGCGGTAAGACGA
ACGCCGGTGGATTAGGCATTTTAATCGAGCTCGCAGTGGTCTGGTGGAAGCGGCTTGTTGCGGTAGTGGGCGCCACGCTTTGCGTGGCGGAGTTCGTAGC
CCCAGTCGCTCAAAAGGTCGTCCGCGGAGTCTTTCGCGCAGTCGGGAATGAGTCGAGCACGTCAGGATCGCTCACGTGAGCAGGGACGTCCTCAAGCAGG
TGGTGACGCGGTTCCCATGTATCGCTAGCAGGTGAGTGTTCAAGCCAGCGCACCCAGTAATATTTATCTGGCGCCTATCGACGACTCGCGCGCGTACGAG
AAGCGCCAACTGTATCGTGAGGAGACGCCTCGGGATTCGCGCGCGAATCATGGTCGAACGAGCGCTCCACAATGTGCGCACCCGATGCGTCAATAAGTGG
ATGAGGGTCATCATGCCGAtactggctgctgcagatccgcGTGGCTCCGAGGGGACCGACGTCACGGAGCGCCTGGCGATTGAGCACTATTGGCTGATGA
AGTTCGAGGATGACCATGCGAGGGACGAcgcgatggagctgcggaagaagctgcgacTCAGTCGGAGCAGGGGTGACGCGAGATGATGGCGCGGCTGCGT
CATCTGGAGACGCTTGTCTGTGGCGCGCCACGCTCGGCGACGCGGGAGGAGCAACGGCTCTTGGCGACTCGGCGCCAGGGACGTCAGCTGGGTGGATCCG
ACTACGCGCCCGTCGTTGA