Description :
From Genome Similarity Track
Location :
Scaffold_371:548- 2298
Transcript NameFunction/comments
Phypl_g7532hypothetical protein PHYSODRAFT_342274
Phypl_g7533hypothetical protein PHYSODRAFT_378025

Sequence
1750 bases(100 bases per row)
AAACGTCTTGCATCTTCACGCGGTGGATAAAGTTGTCTTGTATGTAATCGTAGATGCTGCTTGCTTTGCTTCCGCTCTTCACAAGTAGTTCCACGTTGCT
CATTAGCGGAGAATCATCTGGGACCTGCCGGATGCTCGGGTACGAACGGAATACTTTTTCCGACACATGATGGTTATGCCTGTAGAACTCTAACTTAACC
TCGATCCACCTTTTTCCAGACGTACGCTCATAGACTTGGGCAAGAAACCGAAACTTGCAGCCAGTATAGTTGACCCGCTGGACAGGCCGGCATCCAGTTG
AGCGCGACCGCACCTTGCAGCCATGAGTGCAAATGTAGAGTCGTTGGTAGGGGTCCATCTCTTCTGGCACGAGCGGTATCGCCGAAGGCGGCTTGTTAAC
GTATCTCTTCTGATTCTTCAGCCGGTCATTCCGCAACCGGACATTGAGGGTCTCGGTGATCACTGACACCGTCTTTGTGCGTTTCTCGTATGTCTTCAAA
TACTTGTCAAAGCTAGCCCAGGACTCATGATGCTTCTTCAACGCAGGCACGTAATGTAGCCGGTCTGAGCTCTCCGATGACGATATCTTTCTTGACGAAG
CGCTACTTTCAGAACTCCGATCACCACGCTCACTTTCTTCATCACTCTCCTTCTCTGCTaccttctcctcctcagctacatcctcctcctcagcttcttc
ctcctccttagcttttcctcctcctcagcttcttcctcctcagctTCTCTCGCCTCCGCAGCTTCTTTCGCCTCCGCAGCTTCTTTCGCCTCCGCAGCGG
CTTTCGCCTcctcagctgcagctttctcTTGTCTTTCTTCCTCTTTCAGTCGTTTCTGGATTCGGTCAGTGTTCCTGGTCCGCGCCATNTACAAAACATA
GCGAAAACATGACCAAAACATGGTCAATAAATGGCATGCCCATACATGCACTCTTACATCACTCACGCCGTCTTCACACCGTATGGGGGGCTGCTAACTG
CGTATCGCGCGGAAAGACGACAGAGAAACCTTCACGGGCtacaacgacgacgtcagGTGTGTGGTATCCAAACGGTAAGTGTAAACAGGGGGTAGAGAAT
AACGAGATCCTCACCTTGGCTGGTGTGACAGCGAGGCAGCTTGTGTCGCGAGGCAGCTtgttgtcgcgcagctcgtgtcgTCGCGTTAGGGGGGGAGGGC
GTCGAGTgtgtcgcgcagcttgggcCATGACGTGTGGCACGGGGGGGGGCAGCTTGATTCGTGGCGTGTGTGCCTCCGGGCGTCAAATCGGAAATGAGCT
GCGTAAGTAATTAAAAAAATATTAAAATACAACATGGACAATACATAAACAAATACCTGGTCAATACATGGATTAAAAAACATGGGCAGCATATTTTCCG
AATAATTTTTTTGGTACAGCTGCGGGACGCTCCGGTTATATTGGTCGTAGAAATTGGTCGGACATGGAGATTGGTGACGGACCACCCAAGGGCAAGTGCC
CGACGTGCTTCAAGCTCGTGTCGAAGTCGAACATGGCCAAGCACCGCAAGGTGTGCGGCAAGAAGAATCCACAGAAGTCACCGATGGTGATAAACCGCGA
CTCGTACGCCCgcaacaaggacaagatcCTCAAAAAGCGACAAGAAAAGCGCGTGTACGACCAGTTCCGACGCCTCAAAGGTACATAATTGTAATTATTT
TGCATAATTTATAACTATTTACGTGCCACTACAGGTGGCTCGGAagcagc