Description :
From Genome Similarity Track
Location :
Scaffold_1946:548- 1799
Transcript NameFunction/comments
Phymu_g13774hypothetical protein PHYSODRAFT_258359

Sequence
1251 bases(100 bases per row)
ATCGGAGGAGCGCCACCGTAGGTGCCAACACCAATAACCTTCTCTTGGGCTGTGACCAGGTTGTTCGCGACGTGCGAGCcgcggttgaagctgatgctTT
GGTTGGCCATAGCGGCAGCCCACTCCCAACCAAACTGCTTCACATACAAATGGTAGACGAACAGCacggcgtcgtcatcgtGAGGGTACGACGAAGCGAT
CTTGCCAGCCCATTGAGGATCAACTAGATCAGCCGGCGACGTCGGGGCATCCAGTCCACCGAGGTTGCTCGAGTCGTAGATGTAGCTGAAAGAGTTGACG
CTGTACGCGAACCAGGCACCGCTCTCGTCCTTGAGGCTGTCGTAGATcttggagaagttggcgGGCTTGTACTCGAGCAGGTCACCCGCGCTAGCCCAAC
GAGGGAAGTTCTGCACGGTCTGCAGCGCCGTGATGTCGGGGACGAGTGTGTCGGTTTCAAGCTGGTTGTCGATACGCACGTCGTGGTacttgctgtagtc
gacGACCATGGTCATGTTGATCCCTGGGAAGGCTTCTTCGAACGCTTCCTTTAGCGAGTCTTGCTGGTTCGCGAGATCGCCTCCATGGTAGAAAATGAGC
TTGCCGCCTTCAGTAATTGCGTCTTCGTAGAGCTCAGCAAGCGTCTTGgtctcttcttcgacagcGCAGACGCTCGAAACCACGAGGGCGAATACAGCAG
CGAATGGTGTGTAGAGTTTCATCGTCGTAGGAAGGTTGGACTGGTAGGCACCCGTCAATTTGGAGAATGAAGTACCAACTCATCGTGACCCGCTCGGATG
GTGAGCAACCTCCTCTCTGCGGTGGCGACTAGCGCCATTCCTTGGGTACCATCAGATCTGCAGATGGATCTCACGAAAGCACGAAACCCGTTAAAGGATA
GGCTTAGAGTCTAAGGCTTACTCAGCCTTAGACTACATGTAAGGTGGTGATCTGTTGTCTGTGCAGGAATTGACGTGACCCCACGCACGTTCAACGTTTA
AAGCTGAAATTCAGCCTGAATGACTTTGCCCACGGTGTACCTGCAAACAACTTGTCCGGTGACAAATAAACGTCCGAATAACTAACAGCAAGAACACCCT
GTGTTGATGTTTCCCAAAATTGCATGAAAATGTTTTTGCGTTCCATCACACGTCTCAAAGCAGCACATGGATTGGAGTtagagctgtttcgtgcattgcA
TTAAAGTCTTTAATGCACTTTTTGGGCAGTCTAAAATAGTTTCGTGCAAAT