Description :
From Genome Similarity Track
Location :
Scaffold_821:5479- 7712
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_821-fgenesh-gene-0.1Arginine biosynthesis bifunctional protein argJ
Pytve_DAOMBR484maker-pve_contig_821-snap-gene-0.9Leucine-rich repeat-containing protein 56.

Sequence
2233 bases(100 bases per row)
GAGCGGTAACCAGGTGCTGCCGTGCTCCACGGGCGTCATCGGCTGGCGCATCCCCGTCGACGCCATGGTCGAGAACGTGCCGCATCTGCTCGAGAACCTG
CAGTCCGAGTCGGTGCTTCCCGCCGCCGAGGGCATCATGACGACTGGTATGGCAGCAACAAGTGCTTGTTTGATTGTAATGTTCCCGACTCACGCTGATT
GGTGTGGCGGATAGACTTGTACCCAAAGATCCGGTCCAAGGACGTGGCGGGTGGTCGCATTGTCGGCATCGCAAAGGGAGCGGGCATGATCGAGCCGGAC
ATGGTACGCTCCAGGGTCGTGGTGTGCGATGTTCGTGATGTGAGCTCACAAGATGTCTTTTTGTCTAGGCGACGATGCTCTCGTACATCCTCACTGGTAC
GGTCTCGATGTTCACTTGATCGATGTGAGTGCAAACTTGAGTCCTCACCGTGGTGCTCGCTAATCTGCCAGATCTCTCGGTCCCGCGCGAGTTGCTGCGC
CAGGCGCTGTTCGAGGTGGTGCAGGACACGTACAACGCGCTGAGCGTCGACACGGACCAGAGCACGTCCGACACGGTGACGATCGTGTCGTCGGACCAGA
TCCCGTTCGACGTTGCGAACCAGCTGGACGAGTTCAAGCAGGCGCTGAAGGAAGTGTGCCAAGGCCTGAGCGAGGACATTGTGCGCAACGGAGAGGGAGC
CCACCATGTGATGCGTGTTGTGGTGCGCGGCGCCACGTCGGTGCAGATGGCCAAGGGCGTGGGCAAGTCGATCGTCAACTCGCCGCTGCTCAAGTGCGCG
GTGGCGGGCAACGACCCGAACGTTGGGCGGCTCGTCATGGCTGTCGGCAAGTACATGGGAAAGCACCACAAGGACGTGGACATCACGCGCCGCATGAAGA
TGAAGGTCGGCGGCGTCGTCATCTTTGAGAACGGCGAGATGGTGCTGAACGACGAGATTGAGGAGCTGTTGGTCAAGCACATGCGCGCGGCGCAGCTCAC
CGAGCCTACTCGCGGCGGTCTCGACGTCACTTCGCGGGACTACCCGCCGCACGGCAAGTTCGTCGAGGTGCGTTGACAGAGTGGTGTTGGATTGTTTTGT
GTGCCAGTCTAATTTGTGCTATATCGCTGCAGATGGAGATCGACCTCGGAATCGGCAGCGAGCAGTCGCAGGTGCTTGGTATCGACCTTACGCACGAGTA
TGTGGCCATCAACGCCGACTACCGCTCGTAAGCGTAGACGGATTGGTGTGTGAAACTGGTTCGATCCCCCATTGACCCAGAGCAATTGCTGACTGCTTTC
TGGATAAATACATGTCGGTGGGTTGAGCTGAGCAGGTGTATGTGACTAGTTTCTATTGTGCGCTATTCACTCGTGGAGCTCATGACGAAACAGTCCGACC
ATGAGCTGCATGCGTCGCCGCACGCGGTCACCATCCGAATACACCTGGCTCAAAATGCGCTCCAGCCGCTCGGCCTCGATGCCGCGAAAATACCGTCGAA
AGCCGTCACGCGTCTTGGTTTCTGCCACGCTCGGGTGTTTCCCCTTCATGCGCTGCACAACGACATCGTCTGTCTCGTTGTTCGCTGGCCCAAGCGCCTG
ATCCGACGGATTGATCGACGCCAGCTCGGCTGCCTGACCGACACTGTTGCGACGAACGCTGGGCGAGAGACTGCTGCGCGCCTCTTGCTCGTCCACCTCG
TCCCGCCACTTGTCGATCGCCTCCAAGCTCGCCGCAACATTGAAAAACGTGGCTCGAGGAACCAGCGGCGGTCGCGTTCCGGCTGGTTCTTGCTCGACGT
GGAGACTGCTGTAGCACCAATTGAACAGTTAGCCAAATGCTCGGGAGATCGAAAGTGAGACAAGCGGCGTGCAAGACTCACGCACTTACTGATCGTCGCT
GTCGCTGTCCTCACTGTCGCCCTCTTCGACTGTATCTCGGCTCCGACCGCGCTGGAACACGCGCTCTTGCTGTTCTTTGATCGAGAGCGACGTCGGCAGG
TACTGCTTCGCGTTGGATGTATCGATGGCCGGCGCGAGCGCATCCAGGTTCCACTGGCTATACTTGCCGCCCTTGCCCGTGGCCGTGAACACTCCGCGCG
ACGTCTTCATCACTGGCGACCCCGGTCGCTTGACGTCGTCACTGTTGCCGTCGTCAAGGATGAGAATGTCCACCGAGGGCGTCGAGCTGCGCTGTCTCGG
TTTGGATTGCGGAGTCTCATCGTTGCCAGACTT