Description :
From Genome Similarity Track
Location :
scaffold_584:5479- 7688
Transcript NameFunction/comments
Pl_103643hypothetical protein PHYSODRAFT_454958
Pl_103644hypothetical protein PHYSODRAFT_355348

Sequence
2209 bases(100 bases per row)
TCGTAGTATTTCTGTGCATGTGTCTGCACTTGACGAGGTGAGCGTGTGCCCACGTAGCTGGCGATCTTCTTCCAAGGTCCGTGCGGGTAGAGCTTGAGTC
CGTCCAAAAAGCGGTCGTGCTCTTCACCTGACCAGAGACCTCGCTCAATGCAGCGTGTGCTGTTCGTGGGTTTCAACATGGCAACTGGAGATGCTCACGT
GTGCGATGCAATGCGAATTCGGGACTGGACCGCCGTCTGCTGCAACAAGAGTTGAGTGAAACACTCCTCCTGACAAACTCAGTCTGCAGCTCGATTATGT
CCCGCTGGTGTTTAGTCGGCTTGGCGAGGCTTTGTGTCAAACACATCGGGGGATCCATGAACGCGAACATGAGGTGGGCGAATATCCAAGCGGTAGACGA
GTGTCATACGCCGCAGCGGCAGGTTGGACACGAACAGCTCGACGCTAGCAAAGCATCAATGCCATCAGAAGCGCAAAGTGGGTTCATTTCGCTGGGCTTT
CCCGCCTCCGACTCGACGATTGTCACAAGACTCTGCAATACAGTGGCAACGGTCACCACGATGAAGTGCTGGACTCGGTGTTCAGTTGACTCCCACAGAG
GCCGAAAATCTCCACGAGGCACAGGAGGTCAACCACAAAGCGAAGACGGTATTTGCTGTTAGCTTATTCATGTAGACCGAGGCTTAGGACGGTGGTGCTG
CAATTGGGATAGCCTACAGCCCGCCTCAGTCTCTTCCTCAGACGCACAGTCGCCAGGCCCGCCAGCTGGACGCAATTTTTGAAGCAGCGCCTCGTTTTGC
TGTGCGATCGCACTGTGCGCCTCTGATGGGTACGCTTCAAGTGGAGATGACTACCAATGACTATCAATGACTACGGGACGCGTTGGATTTGCGCGAACGA
GAACAGGGGGGACTGGCGCACGTGGCCAGCACTCACCTCAACAAGCAAGGCCGAGGCAGCGCTTAGCGAACTCTTAACTAACATAGCTGCTACGTCCACC
GTCAACGTAGCAAATACAACAGCATGGTCTCAGCGGGGGGATAACCAGTTCGTGTTGTGGATATTGCAGTAAAAGGCGCAACATTTGGTTGACTAGTAAC
TCCATAGCGGTCATCATCCGAAGTTTGGGAACTCACACACCTGCTCTTCCGTGTGATGTCCACCAGCGAAAATGGAGCCAGCTAGTTACGCGTACAGGAC
AGACTTTCGACGGCATTAGTTTGTTGGAGCCATTAAGACCTAGATGCCTTGATTATCGCAATGGAATCTCGACGGGATTGGTACAATGTACCGGTCACCA
GTCGCATAGACTAATCATTTCAAGGTGTAATCACAAAATGTAGCCATTTTTACAGTTCCAGTGCTTACATGCAGCTATTTCGTGTAACAGCGAGCAAGAT
ACTTCTCGAGTGAGAGAAGCATGGCGGGTGGTGTATTCTGGTCTTGGGCAGCCTTGATCACGGAGTTGACGCTGTCCTTGCCCAGTAGGCGCTGCTGCAG
CGCGTGCTGGAGCTTGCTCAGGATCCTCTGATGCCATACAGGCAGTACAAGCGGCAGCACCGTGCCTTCTCTGTCCGATTCTGACCAGAAAAACTCCACT
ACTGTTCGACTGCAGTGCGACAGCAGAGTATACTGGTCGAAGGGCAGTCGATTCGTCTGAGAAAAGAGTCGAAGACGTCGACAGTGCACGCGGAGGAGCT
CCCCGCTCGTGAGCCCTTGCAAAATATCTGTGAGCAGAGCCATGGGGTCAACTGGGCGAATAAGCTGCCGAGCGCATATTGCCACAATGTCACCCGCGCG
GGTATAGATGGCTGTGATCTGCTCGTGCAGCTCAGTAGGGGAATGTCGACGGGGTGAGATCTCGGCTCCATCACGAACCACAAGACGATCTCGCTTTCGT
GCTATCACTTGTTGCAGCGAGATCACGCTCTCGCCATCCTGTGGAGCCATCACCGTAGCTAGCTGCCAGCTTTCAGGATTGAGAAGTACTTTCATGTTTT
CGATCGTAACTCGAGAGACTTGTCGGGTGAGTATCTGCAGCATTCGTCGTGGACGCTCTGGCTTCTGTAGCACACCAATACTACGCAAAAAGTCTTCATC
TTCTTCTGACGGTCTCCATATCCGTAGCACATGGACACCCCAGAGTGCGTCGCTGTAGGCCGACGGAACAGAGATCAGATCGAACCACGCACGCGATGTC
AAACTTAAA