Description :
From Genome Similarity Track
Location :
scaffold_42:547714- 567154
Transcript NameFunction/comments
g11352.t1hypothetical protein
g11353.t1hypothetical protein
g11354.t1 hypothetical protein PHYSODRAFT_329696

Sequence
19440 bases(100 bases per row)
CCTGTGTCATTTCGTGGTCCGCGTTTGCGTCACTCATCGACGCACTATCCATTGCTGCTTCCTTCTCCATAATGTTCCCCGATACGCCGTCGAGTTTGTC
GCCACTTGGCGCTTTGTAGTAGTGATGCATGAACTGCTGCATAGCTCGGCGCCCCTCTTTACGCGACTGTCTTGTGCTGGTGCGAGTCGGCGACCGTGAT
CTCGCCTTCTCTTCTGTTGTGCACGTCTTCATCAATTTCTGCATAGTTTGGATTTCCTCCGTCCCTGTTGCCAATTCCCATTCGGCTGGCGGGTGCCTCT
TTGGTGAGGTGGATCGCAATTCACTGGTACATTGGCGGTCTTATTCTTTCCCCCGGTGAAGGCTCTGAAGAATTATCCCGCTCCTCGATGTTGTTTCCTT
CCTCGCGAGGGGTTCATCTGATGTCCCAACTTTCTTTACGTTGGATCCCAACCTGTTGCTGTTAGAATCCTCCTCTCTGTGGTCCTTCCCCGTGGCGATA
TACTCCTTGTCGAGACTGCGGTCCTGTTCTTAGTTGTTTCTTCGTAGGTTCCCCCGTCCGCTTCATGCACCTCCTCCACCATCTCGATATCTCCAATATG
TTGTTCGTCAGTTGATGGTGAGTCAGCTTCTGGGTCAACTTGTGCGTTTTTGTATTTTAAGTACTTGTTACCAGTGTTGCCGTCACCCTCCTCCGCTATC
TGTTTCGCATCACTGTGCACTTTGTTTGTGTGCTCATTTTGCGTGTTGTGAGCTGCTGCTTCCTCAATCTTAATGCTGTGTAATTGTTCCCATTCCCGCG
GTAGCGTTGGTCCCTCTGCTAGCACCGACGTAGGTTGGTGTTGGGCCTCCTTCCTTTGTCCCCGTGTGGGCACCTGCTGCTCCGTCATATCCGTTAGATC
TTGTTCCACTTTCCCGTCTAGTCCTTTAAGCATTCGCCTTCGCTGCTCCATCGTTGTCGGTAAAGCTCGTGGCTGGTACGTTCTGGAACTCTTTCCAGTT
TTGGACGGCTGCGCACCTATCACTCTGAATGTGTGTAGGCGAACGGTGTTCTCCATAGTTGCTTCCTCCACTTTGCAATATCTGGTCGGATGCTCCGGTG
ATCTGCATGCTTTGCACGGCCAGTTTACATGAACGTCCTGATGATGCACCACCATCTCTGCATCTTCATGAATGATATAGCCCGTGTCTTTCAACTTCGG
TGGGCACGCTTTCGCACGTATCTTCACAATCCACTGCTTGTCATTTATTCCTGTGTCTCCAATTTCCGTGTGAGCCAAAGTTTGCACCTGCAAACCCATC
TTTTTGCCTAACACCCATAACAGATCCTTGGATGCCATTGCCCCCTTCCTAAGCGAGACTGTGAAATTATAGTAGTCTAATTTCACAAGTTGAAAAATCG
TCCGAGCCTCCACTCTTTGGCTTTCATAGTCAACTAGTTGCAGCAACCTCATTGCTAGTGGTAATCTCCACCCGATCCACCTTTTCGCAGCATTCTTGCC
CTTGAAGGTGACTGTGATAACTCTTGTGTCACTGTCGAGCTCAATTCTGGATAGTGCTGCTTTGAATTCATCAATTTCCTGTTGTTGCTTAGGCGGCGCC
TCTGCTCCTACCGTGATCTGTGCTAACAGCGCTCCTCTTGATAAATTTCCCCCAAAACGCTGACCTGGCGCCAATTGCGCATACAGCGGATATTCCAGAG
CAATGAACATGTCCGTGAAAGTTGCTAGTTCCATTGGCGTCATAGACTGCACAAGAAAACGAGGTGGGAAAGGCACTTCCAGTTCCTGATTGAGAATCAT
CAACAGCGCCCGATCTTCATCTTCTGTCCGTTCTCTGAGCTTCGTTATTTCTGCTACTGGTTTCATACACAATTTGAGTAGGCGCTGTTGCTCCTCCGTG
AGGTCCGCTTCTGTCGCCCTGCCTCCTTGTTGCGTTACTGCTCTTAGATAGTCCCCCGTCGATGGCGTTTGTTGTTGTCTCTTTGCCTCGTGCTTGTTGC
TCGTGAACGTGAAACAGTGGATGCGCTCCTCTATTTCCTCTTGGTCCAGCCCTTCCTTCACGACCCACTGCTTCAACAGAAGTTGCATTCTTCCGGCGTG
CTCCTCGTTCCCATTCTCCCAGAAGCTGATTATGCCCTTGTATTTAGCGCGCTGCTGCGACGTGATGTCATCCTGCCATTCGACTTCACTCTCCGCTGCT
TGTCCTTGGCTCTTCGATGATACCGCTTTCTCGTCTTCGTACTTTTGAAATCTTCGCGTTCTGGCCAATTCATTGAGTCGTTGCACCAGATGGAATACAT
ATTCTGCCGGTGCGTCGTTGAGTAGGTAGGACCGCAGCTGCTTGAAAACTACTTCTCCATCTCCCTGATCTGCTCCTCTCCAGTTGCGTCCATTGTTCTT
CCGCTGTTTATCTGCTGAGTAATCGGACTGTCGTTTCCGCTGCGGCGACAGTTTTCTTGCGCTCTGCTTGGTCGGGACAGCTGTCTTCTTCTCCCTTGCC
GCTGAGCTCTTGTCAGCTTTTCCCACCGTAGTCCACTGGATCTCTGTGGCAGCTTTTTGCTTCTGCCGTGTCGACGCCGTTTTTCCTTCGGCTTGTCCGC
CATAATTGTTGTCGACTTGCTTCAGTCCGCTTTTGACACCCATCGCATTATCCCCGATGCCCTGCGCTTCTAATCGCTTGCCCGAGCCGTCTACCACGAT
CGACTCCATGCTCCCCCGTTCCTTGGTCATGTCGTCTCCGTGCTTGCGTCCTTCCAGTCTTATCTGAAAGATTGTATACCGGGGGGGGGTTACGCGTCCT
TCCAAATGCCCCCCCCCCCCCCCGTAAGCTGTTCTCCGCCGATCTGATCCCGAGTCCACAGAGTCTCGTTCGCCAGCCGGCAAGTTGGGAAGTGGTTTGT
TCTTAATCTAGGCGGTCAACTCGCTCGAGTAGAGAACACCTCGCTCGCCTAAATCGAGACCAGCACCGACACCTCGTGTCGTCAATGCGAATGTCGGCCA
GTGTCCTTTTAGTCATTGCTGGTTTTCGCGACGTGATCTCGTCATTTGTCCTGCCCCATATGCGGCTGGAATGCCGAGTCGATCACTACTGGTCACGTAA
AGTCTTGTTCGCTGCACGACGTATCCTTTCGCCTCCATGAAGCTAACAGCGATGCCGCTTATCCTTGCTTGGAGGGATCATTCGCAGTTTTCACGCCTCG
TTCACACGTCGCTCCAAGCCACAAGTGCGATGGTTCTTCAGACAGCACTGCTCTTCGCTGGTGCATGCGTTGCGTGCTTGTTTGACTGCACCGCGGGGTT
GACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACGATCGAGTCCATC
CTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGAATGGTTCTGTAC
AGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGGACATGCACTTCT
CCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGCCTACGTGACGTC
GACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACCGGTCAAATCAAC
AATGACGACTTCAGTGACTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCAAGGTGATGATCC
ACCTCGATAATGGTTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGACGTGTTTGGCTT
CTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCGATCTACGTGGCC
GAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCGCCATCATGGACG
TCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTGCGAATCGGCGCT
GCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGAGCCTAGGAAAGATTGATGCAGATG
TATGTCGAGAAGGTGTCCATTATCACCTTGTTGCGTACAGTTCAGCGGGAAATGTAAAGTCTCCGTTTGTTTAGTCTCCGAATGCACGTGTCAGTGTCAA
GGATTGCCTTGGCACCAGCTGCACAAGCAGCAAGAGATCACGCTAGGATGGGGGCTCGCTGTTGGGAGAATAATCTCTTCAACATGTTGAAGGATCTGTC
CTTGTAGAAGCACCTATCTCGTTGTTCGTTCCTAAATCAACTTTTTGGTCGCCGGACTGCACTGGACCTGCTCGTCATTCTCCAATTCCTACCCCAGGCA
ATCAGTTCGAGTAGACAAGTAGTGGGAACATGGTCGTCGGAAGGACGCTGCTTTGGGTTGGTGTGTGTGCGACAGCTCTGCTCAATGGAGTGCAAGCGTT
GACCAAGGGCCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACACTACCGCGGGCAAGGAGGCAGCAATCGAAGAGATT
CTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATATATTCACCTTACTGAAGGAGCTTGGTACTAACT
AACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAATACGGCTTGGACTACACCCTAGCACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAGATTT
TCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGGCATG
TCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGAGCTGGACCTCTTGTCTATCGGCAACGAGATCACCGACGGATTTCTCTAC
CCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGCTGTGGAAGGCGGCACGGGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGTACAC
AGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACAGTGTCGTGGTTCTTCAAAGGTCTGTTTGATGAAGGAACGGTGACCACCGACGA
CGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACATCGTCACTTACTCAAATGGCAAACACGTACAAG
AAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGTACCCAGTTAGTGCACGGGGTCAGCGCGAGTGGG
TGACAGCTATTGTGAATGTGTTGGAAGGTTTGCCGAACGCGCTTGGTGCTGGTATTTTCTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGGGCAG
CTCGTGCGAGTCAAACCTTCTGTTCGATGTGAACTGGGATAATTGGCCGGAGACGTACGCGACGGCACTTACGTCGGTGGACATGTTTAACTGAGGGTTT
GCCTAATCTTCTCTTTGAAGGTTATGCACATTTTTGCTTACAGATCTAGTGCTGTTAAAACTTGAGTAAATTTCCTAAATGTTTATGGTTTCATGCCGGA
AACCATAGGGTAAAAAACAAATGGCCTTTTTTTTTAATGAACCAAACGCTACTATTATTATCAGTATCTCTTGCTTCTGAACATGGAAAATGCAGTTGTG
AGTTTACTTTTGATTAGGCTTTTGACAAAGTGATTCCTGTTAGTCAAAAAGCGCGCAGTATCTCGATGGTAAGGCAAATGTATATGTTAATACACTCAGT
GTTACATGAGCACATTTTAATTGCTATATGAACTCGCTTGTTTTCGGAGATATTTGACATAATCCCGAGCTGTTAGTACAGAGCTCAAAAAAGAAAACTA
CAATATAATAACGATAGTGTTAGAAATTATCGCATAAATTCAGTGTATGAATAAACAGAAAGCGGGCGCCATTAGACATTTTTGCTTACCTTTTACAACT
TGATAGGCTCACAAATATGTCTGGGGTACCTCCTGTTGGACGAACGGGTCAACTAGCGACGTTGCTGTCAGAGTTGAACCGCCTGGTCGATGAGGACCGT
CTCTTTAGTTGTAGGAGTTTCCGAGGCTGGCAGCAGGACCCTGCATTCTAACACTCAATTCATCCTACATCTTTCCTCACCACGAGAACTTCTCCAAGTT
CCGACAGATCGCGCCTGCTGAACTGCCCACCACGCCTGCAACAACGTGCAACGCCCCCGCCCTCAACAAGGACGTTTTGCAAAACGAGGCACAGTCAAGA
AATTAGAGATGTCAACTCCAAATTTTGGCTGTGTCTGAAACCGGCATATAACACGGTTGGATGCGCTGATCGCCAGAGAACAGCTCTGCTGGAGGAATAA
ATCTATTCACTGAGATTCAATCCTATTTGTCGCCGGGTAAGTAGATTGGTGTTACTACGTATAAGTAGATTGACGCTAAACCTACTTACTCAGACTTGAC
GACGCGAATCTGACTCGGAAAACATTAAGAGAGTTGTCATAAGATTTAAAGATGGCATTATCGGCAAACAAGCACTCTAAGGAGATCCTTCATAAACAAA
CCAACGATGGCAACATCGCGCGTAAGCTGCCCCCTGTGCTAGCATAACCTCGCCGCAACTAGCATACGGGCTCATATCGGCCAGCTGGCATGCGTGGAGC
GTACTTGCCCAGAGCTGAGAGCTAGACCCCTTGTGCTTGCCCAGCTAGCCAAGAAGGACTATGATCGTCGCTAAGCTCACGCCTGTCGCGACGGCATTCA
GGATATGGGCGTCAGACTGCTCGAGTGGGCAGCGGTCACCTCTGTCGAGGTTGATCAAGGCATCCCAATGCAAGAGACACCAAATGCCCACCATGTATTC
GATACATTTGTCCCAGCTAGCCCTGTTCCATTTGCATCAAGAGAGGTGGAAATTATTGACATGACAGACGATGACAAGGTCGATGAAAGTACCTGCTCAA
TTTGCCAGTACGTATCGGTGGATCCGGTGCCACCGCGTTCGTCCTGTCATGCAATGTGCTCCGAGTGTGTGTTTGCTCTCGTCGTCCATTGTATTACAGA
GGATGTTAACCCGCACTACCCCATTTGCCGCGTCATTGTGCTTGTAAAGGCATTTGTTTAAACAATGTTGTATTTCAATATATGAAGCGGTTGGCCGGAC
CCCGGGTTCCCGCAACAGAAACCGAAAAAGGCGGGAATTATTTATTTAATTTTGGACCTGCGGTCGCGGCGACCGAGTGCAAAACTACATCGTTTAGGAA
ACCAATAGCGCATTGGGGCCGTGTCGAGCAGCAAGTCGACCGTGGACCCCGTGTGGAGAAGCAAGACGCCCTTGTTTCAAGAGCATCAAGCGAATATGAC
GCAACGGCGCGGAGGAGGGTTGCGGTCAACAATCCCGCAACGTAAACGGAAGAAGGGTTCTGACCGACAAGCTGCCGCATACCTTCGAGCAGTAGAGCTC
CTGGGTGCTGACACCGTGAAGCAGATAAGACAGGATTGGGAATCTTGGGACACAAACTTCGGTGGCAGGGAGTGGCAACAATCTGAAGGCGTGGTGCTGC
AGTTGATACAACAGGGACTATCCGAGCGCGTGATCCGATCCATTATTCCAGTCGGTGGGAGCCGTATTTCGAGGCTGAGAAAGGTCCTTAAGGATGGAAT
TGACACCTTACACACAAGAAGATTGCCAATCAAGCCATGGCACGCATTTAGTGAGCTGGACCTGGATGCTTTTAAGACTTACTGCGCATCTTGGACACTC
GAGGATGGTTTTCCCTGCGCCCACCGCCGCCCACGTCAGTACTTCACAGAGCCGAAACTGACGTGGGTTGTCGTGCATTCTCGGTATGTGGATGATATCT
TGCGCGCCCATCCCGACGCCAGAACGCTAAGCTATTCACGCTTCACTCAGTATGTGCACTTTTACTACCCTGGCGTCCGCTTAACACGAACTGCAGAAGA
CGTGTGTGATTGTTGTATTCGAAATTGACCAAGGTGTCTGCACGGCGCGCAAAACGGTAAGTACGCCAGATGACCAATCGATCATATTCTCGATGATACC
GCACAGCAACATCGAGTCTGTCCGCAAAGCAGTGTTGGCTGAGCTTTTTGGAGCAAACATCAAAAGTGTTTGGGAAGCATCCGTTCGCGGCGTCCAGCTC
CCTCGCCATCCAACCAAAGAACTATCCGCAAAGAAAATCAAGTCATTGTCAGCTAAGTATTTCTCAATACCACAAGAGCACCTCGGCTACTATCCTGCCG
TGCCTGAAGCGATCCTAAACGCCCCAGAGATCAATACCGAGCACACCGAAACAGGAGACCCCAACACTGATGCCACCGCGGGAAAACACAAGTCTGGTCG
ACCTCACAAGAAGAAAGTGAAGCTGCGAGCTAAACAGCCTTCCATTCTGCAGTTCTTCAGCTCTGCTGCGAAGTAGAAAGATAAAGTAGTTTGACCTTTT
TTTAAAAGAAAAAAATACCATTGCATTTTACCAAATACCGGTTGTTTTGCCAGAACCGGGGTCCTTGTGGGACCCCGGGTGCCCGCCAAACGCTTCATAT
ATACTATAAACTGACGGGATAGAAACCATATCATTGAATACAGAAACAGCAAATCACGTCATCAGCTTTTCAAACTTATTGTACTCGTACGACTGACCTT
GTACAATTTTACACTGAAATCGATGTGTAATCGTGGCCTAAACTTGTATGATTTTACACAAAATCCGAAAGATATAATTATCATAAACATACAATTGCAC
TTGCATCATTTAATAATATAACCTAGAGGGGTTGGTTAGAAAAAATGTATAATGTATAAACGTACCGAATTTCCCAACCAGTTGGCTGTCTCAGACAAAT
TGAATGCCACTTCGTCGTATAATGGTTGATTGTACATTTCGTCAAACGCGTACGTAACGCAGTGTGCTTTATCGATTCCGTTCAAGTACTCAGTAGCTAG
TGGACGTGTGTCAGATAGTTTAGAGTTGTAGAACTTGTAGTTTTCACATTCACTCCGCACCATCTGAAACACGAACGCCTGCTCCGGAGGCGACAAGGTT
GACCCCTTCTTCTCAGCGATCGCTATGATGTTTTGGTCACAGAATCGATGGCTAGATTCCAGGTACAGCTGACTCACAGATGAGATAAATCCGTTTTGGT
GATCAGAAACAAAGATGAGTTTCCATCCATGACCAGCGGCCTCCACCGCATATTTCATGTGCGACAGGAACCAACTCCAATTCATATAGTCTTCTTGCTC
CACCAGAGCAAGACCAAATACAAGAATATGGCTGGCGAGGGGGTTTTGTAGTCACGAGAAGAAACACACCACACTTGTTTATGTCACCCTTTAAATAGGT
CAAGGATATGTTTGTAATATTGCATCGCCTGCAAACAAGCACCAGGAAAGAAACAGGCTATTGAAACCGCCATGGTCGTGCTTCTCCAAACCAAAACTCG
ATTTGGCGTTAGCCTCCGTAACCATGAGCAGATACGCTTCCAATATCTGGTAGCTCTCGGTGATATCCTCGCGTAAAGATCCAAGAAGATCTCGTTTCAA
CTTCGACACCATCGGGCGGTTTGTAGTGATTCGTTGGATTTTTAGAAAATCCAAAATGGCGTCACCTGCGACTGAAGCCCAGGTATTGCTGTAAGCAGGA
AGTATTTCTCGCTTTAGGATGCCGCGCATCGTCCCGTATGGCACATGGCGCTGACATTGCTGTTGCGTATCAGCCAGGTCGTCTTCAACAAACGTGTCTT
TTTGAAAACCAGCATGCATGCGCCAGATTCATCTACGTGACCTACCACTGATTGCGTAACCCATACACCGTGATTAAGATTGGACATTGTTCGACACTCC
CTAGAATCAGCGGCTGTTACCCTCCAGGCGCTTGCACGCGTAGTTCGCGTTTCCTTCCCGGGTGGCCTTTAACCAGCTATTGTTCGTCACACGAAGGGAA
AAGCCCTGTCGACGAGCATACTCCCGACAACGAAGTTGTACATCCTTTCTTGATCAAATTAGCACTTTTACCAAAACAAGTGAACAGTGTGACAAATGTG
TTAATAATGAGAACGAAGTTTTTCGTTAAAATGCTTTTCCCACAAAGTGAAATTTCATGCATTCGTGATTCTAACCAAGTGAACATCTAGCACCAACCAT
TGTATTTGAGCCGCAAGGCACAACCGCTCTCAGTTCCAATCCGCCATACCTTCCTCCGACAAACTACCAGCAAGCAACGCCAACATGAACGTGCGTGGAA
CTAAGGCCCGCATAGTGTGTGCGCACAAGGACGGCGAGAATTGGCGCGCCGTCGCCGCTCACAATGGCATCCCCTATATCACGGCTCGGTGTGCGGTTCT
CGGCGAAGACGCCGATCCCAAAAGATACACGGCGGCGTGCGAACAGCGCGTGTCAAAATGTCCGTCGAGGTCATGAGCAAACTGGAGGAGTATCTCGACG
AAGACAGCCGGCACACCTGCGAGCAGATGGGTGACAAGTCGTGTAGCGACATGGACGTGTCCGTGAGCATATTCTCCGCTCACCATGCTCTTCGGGATAT
GGTCTACAGCCTTAAAAGCTGCGCATTAAGAAGATTTCAATGAACAAGACGGAGAATAAGATCAAGATGATGGCTTTTGTGGAGAAGTTGAAGAAGTACA
GACCTCTTCACTGCGGTATTGGCGACAGAGGAGTACTGTATACAGGCACCGATGAACAAGATTGTCGTCGTGACCAACAATGCGTCACATCACGGTGAGG
TGAAGACGTTGGCGAGGGAGATGCTTGTGGTGGACGGCATCATGAACAGCAACAAGCTGGTCGTGCTACGCCTCGCCCCGTACAGCCCCATGCTTATCCC
AATTGAGGGCAGCTGCAACGTGTTCAAGGCGAAGATGCACCGTTACATTGCTGAACAGAAAGAAGGGTTTCTAGTGAGGGGTGAGTACAGCACGTTTTCC
GCGCATTGTTAGGCTCTCATAAAGGAGGCTGCTGAAGTAGCCAAGTTTATAATTACTCGTCGTCTGGTTTGTCACATGGAGCGCCATTGTCTTAAGGCGT
CGTTTGCCGCCGGCAGAGGCGAGGACATGGAGCTGGGCAAGTAGCTGGGTGTACCCCTATTCACTTGGGTGAGAGCTCGACTACAGTAGCTCGATTTTCA
AGTTGTTAAAAATAGCTTTTTCTATTCTAATTATTTTGTGCAAAAAATTGGATGCTCACTTGCTTTGGTAAAAGTGCCAACTCAGTTATCAAATGGTGTG
GTGCTGACCGTGTCTCAAACATTATGTCCGCCAAGTTCCTTCCGTGGTCTGTGACTTGGCCATATATGAAAGAGTGTGTACGATTCATCTGGAAATCGAC
ATCACTGTGAAGGAGACCCATTCCTCGGAGATCTTCGATGCTCGCAGTCTCGACGTGGCTAGTAGAAGTAACTAGAATCGTTATATTGTCTCACGCTGGT
ACGAAGGTTGGACATGGTAGGTGGAGGGACAGCGGAGAGTTCTGTCGAATAGCAGAATGAGGCAAGGAATGTGACAGCAACTTGTGTGGTGGGCTCACGG
TTGCGCAACAAGTGGATTCTTCTAGGTAGTGTTTTCGTAGCAGCAGCAAAAAACACAGGAGTCTTGACACCTCTGCCAAAGAGTCGTTTAATGCGATGCT
TTAGTAGGGCATAATATATGTAGGTACCAATTGAAAACGGACAAACTTTAAAAGTGTACGAGTCGAACGCTCTCGCAAATTTTAATTTATTTTATGAGTC
GCACGATTCTACAAAAGATAATTTTAATCGAGTCGTAAAAAGTCGTAAATTTGAATTAATAATTAGGAAAATTAAGGATAAATAAGGTTTGGCTTCAATC
TACTGATAAGCAGTATTAATAACACCAATCTACTTACCCGGCGACAAGTAGGGCTGAATCTCATTGAATAGATTAGTTCCTCGCTCTGCTGTGACGTCAA
CACAGAGATCAAAGGCACCCTAGCTCGAGAGTTACTATCCGATGCCATAGATCTCGGGAAGCTCCTCGATCTCCAGAGTTAACTTGCCTTGCTTTTAATT
AACGCAATCAGCCGTGTTGGCAGCCGGCTGTTCACTTCGCGGTTTCGGTTGGTAATGGCAGTCTCCATTGGCAGCCTTGTGGTGCTACCACTGGTGGTGA
TGGCCACAAGGGCTAATTCCGTCATGTCCTCTGGGTAAAATCTTTCCTCGGCATGAGAAAATAGACGAATGTGAGGCCTTCATGTTTCCTTCAAATGACA
TTGGCGCTTGACCATGGTATTTGGCGCCCAGATTTAGGGCCGCTTTTTTGCAATTCAGAGACCCCGTAATCTTGATTTCAGTATGGTCTGCCCTATTCAC
TGAGTACGGTTCACCAGATTTTGAGATGGTGAAAAGTGTCAAGTCTCCTCTGCAGCCTGGAGGACATGTGTGCGCGCACCGAAGGTGAAATGGTTCTACG
CTACATGTAAGCTTATCCAGTTTAGGTTGGGTGCAATCAATTAGATCACATCTGCAGGGGAAACAGGAGCCTAGTGGCGAGTGATATAATACTTTCGCCG
TGCTTATTTGGCACTTCGCTGCTCGTTTTCTTAATCTCCGCCCTCTGGTCGACGACTAGTGGTCGTACATTCGCCTCTGGTGCACCGGATCTGCTCGCTT
ATGTCACGCTTCTCCATCCTTGACAACCACTTCGATTTGTCAAGTGAACGGAGGAGGGAATTATGCTCGCTCGGAGAACGCTGCTGTGGTTGGGAGCTTT
TGCGGCACCTCTGCTCAATGGAGTGCAAGCGTTGACCAAGGGCCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACTCC
ACAAAGGGCAAGGAGATGGCAATCGAAGAGATTCTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATA
TATTCACCTTACTGAAGGAGCTTGGTACTAACTAACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAGTACGGCTTGGACTACACCCTAGCACAAG
CTCAGCGATTCTCCAAAGCGGGATTCAAGATTTTCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGA
CGCTTCGTCCGTGGAGACGTTGGCGGCGGCATGTCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGAGCTGGACCTCTTGTCT
ATCGGCAACGAGATCACCGACGGATTTCTCTACCCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGCTGTGGAAGGCGGCACGGGAAG
GCGTTGCGGATGCCGTGACGGCTGGAAGTACACAGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTCAAGGG
TCTGTTTGATGAAGGAACGGTGACCACCGACGACGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACA
TCGTCACTTACTCAAATGGCAAACACGTACAAGAAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGT
ACCCAGTTAGTGCACGGGGTCAGCGCGAGTGGGTGATGGCTATCATAGACGTTCTCGAAGGTTTGCCGAACGCACTTGGTGCTGGTATTTTCTACTGGGA
GCCGGGCTACATCAAGGTGCCGGGTCTGGGCAGCTCGTGCGAGTCAAACCTTCTTTTCCACGTGAACTGGGACAATTGGCCGGAGACGTACGCGAATGCA
CTTTCATCCGTTTACATGTTTGGCGACAAGGGCTCTTCCCAAGGCAACAGCTCTGCTCAACAGACCAGCCCCACTCAAGAAACCCAGACCGATCCTTCGC
AGCAAATGCAATCCAGCTCCTCGCAGCAGATGCGATCCAGCTCTTCAGAACAGGAAAACGAAGATACTGAGCAGCAAACGGCAGCTTCGGAAAGTACCAC
GCAGCAACAGTAGCCATCAGAAAATATCCTGAAAATATCAACAGCTCCCATCGAGCAAAGCTTTGATTGAAAACTTGAACCACGAGACAGAGCGAAATAC
AGTGAAGCAAGCCCGCTTTCAAATACATGTAGTAAACAATGGAGGTGCCGCCCAGCTTTCATCCTCGTGCAACCACAGCCTTCGGGCACTCCGGGGCTCG
TCTGCAGTGCGTTCGGCTTTGGCACGGCGTAGAGCGTGGAAGAGTGCTACTGAAAGCGCTGACGAAACCAATGCGTGAACACTTGCAGTGACGAGTGCAA
GGACCACATAGCTGCTTGATCTATGTTGTCGATATTTTCGAGCTCAGGAATTCACGTAGGAGGTCGATCCGAGACTTCTGTTAAGGTGGGGTGCTACCTG
GGAAGCACACACCCAAGGGGGCATATGTCAGGTTAGTGACGCGTAACACCGCACTAGATCTACTACAGCAAGAAACCCTTGAGATGGGATACATGTACTC
CACCAGTGAACTTCAACCGGAAGACCTCAGCCGAGACTTCAACGGAGCAGCAATCTGGTTAAAGACGACACTGCCTGCAGGCTTGATGCACTGTTCGAAT
GAGTCAGCTACTACAGTCATACTTCAAGGATCAGACTGAGCAACTACACTATGAGCTTACGTGGTATTTTTGCAGCTGAATGTAGGGATCCCTCCCTCCT
CACAAACACCAGTGCACTAGTCGTGCACTCCATTCCAAGAGCTTTTCGAGAAGCTCATTCCCGATTTTCAAGTCTGCTCCGCAAGTCCAACAGCAAAACA
ACCAAGGAGCCGAATGTTTTTCAAGTCGGCACTTCTCGTTGCCGGTGCATGCGTTGCGAGCGTGTTCACCACCGCTGCAGCGCTGACCAAGGGCCACGAC
TTGTCTTCCGTTGCTTTGATGGAAACAACCCAAGGTGCCCAGTGGATCTCCACCTCTGGCAAGACAACCACGATCGAATCCATCCTCGGGGATGCAGGCA
TGGACTCTGTTCGACTCCGGTACGTCCACTTGTCAGCATTAACCTACACCACTCACCTCTCTGACGGTATAACGCAGCATTTGGACGGACGGTGACTATG
ACCTGGACTACACGCTGGCGTTGGCCAAGCGCTTCTCCAAGGCAGGATACAAGATCTACCTGGACATGCACTTCTCCGACACGTGGGCAGATCCGCACAA
GCAAGGCATCCCTGCAGCATGGGACAAAACGTCGGTCACGACGCTGGCTGCTGCTCTGCGATCCTACATGAAGTCGACGTTGAAGTCCTTCACGGACGGC
GGTGTCACCATCGACATCCTGTCGCTGGGCAATGAGATCACAGTCGGATTCCTCTGGCCGACGGGCAAGATCACCAACAGCAATTACGGTAACTTTGCTA
CGTTGTGGAAGGCTGCGCGTCAAGGAGTGACGGATGCTGTAGCGGCCGGTACCAAGAAACCCAAGGTCATGATCCACATTGACAACGGATGGGACTACAG
ACAACGACACAAATACCCGGGCAACACAAAACCCGGGAACACGAGAAAATACATTTATTTTTACCAATCAAATTACTAGAAAAATATATATATTTACCAA
TCATGAAAAAATAAAAATTGGATGGCCAGCAGCTAAAACGCCGAGGCACCGGCCAGTCCTGCCACTGCAACAAATGCCGCGGAAGCAACATAGCTACACC
ATGAAGGTGAAGCTGGTGGCGCTGGATTCCATCGAGCGGATCGGCTTGACCGCGACGGTCGCCGAGCTCCGGTACCCCCATGGGACCGTGGACGGGTGGT
GGCGGGCGCGTGACAAGCTCCGAGCGTACGCTGGAAACAAGCTGTCCAAGACGATAAATGGGCAGGGGCGCAAGGAAAGCTTTCTTTCACCCCAGCCCTC
GTCACCTTCATGAAGGACACTCGCCGGGACGAAGAGGTACGTTTTATCATATTTTACAATTTTTGCATTATTTCTAACGTTAAGCGTCTATGTAGTGGCT
CACTACGTCGATAATGATAGGTTTTATAGCGGAGAACTATGAAGAATGGCTAGAACAATACGAAGAAGGCAAAACGTCGCCTCAGAGCTGCCGAAAGGCG
CTGGAGAGACTACTGCAGAGAACAGAAAATCGGTAAAAACTTTTGTCTCAGTACATTGAACATTATATCTATACTAAATGTGTCATGTACTGTCATTATG
TACTGTTTTTAGATATGGATTTTCGACACAAAAGGCTCAAGAAACGAAGTTGCCGTGCTTAGATCTGATGCAGATTAAGCAGGACTTTGCTATTGAGTTT
TGGTCTGTCTACAGCTCCTACTAACCTTCTGAAATTCACAATATGAGTTTTCAGAGGAGCTAGTAATTTGTAGCTTTCAGACAGCAATTCCTAGGATCGA
GTCAATGACAGTTTAAGCGATTAATAAAATGGTGTTTTTTATATTTTCTTTGAAGTTTGTATTTACCAATCAGAGCATTGGTCTGTGGCCTGTTTGGCCC
GGGTATTTGTGTCGCTGTCTGTACGCCTACGTGTCCGCGTTCTTCACCGGGCTCTTCGCTACTGGTACGGTGACTACCAGCGACGTGGACGTGTTCGGCT
TCTCGTTCTACCCGTTCTACGACTCGAAAGCTACGATCAGTTCACTCAAGTCTTCGCTGACTCAAATCGCCAACAAATACCAAAAGCCGATCTACGTCGC
CGAGACGGACTGGCCGACGGAGTGCTCCACTGTCACGCTGAGCGCTAGTTACCCAGTGAACGCCAAGGGCCAACGCCAGTGGGTAGCTGCTATCATCGAC
GTCCTGAACGGTTTGCCAAGCAGCTTGGGCGCCGGTATTTTCTACTGGGAGCCGGCGTACCTGACGGTGGCGGGTCTAGGCAGCTCTTGCCAATCGGCTC
TACTCTTCAGCGTCAACTGGAATAACTGGCCGGTGACCTACGCGACGGCGCTCTCGTCTGTCTACATGTTCAGTTGACCAACCGGTTGACGGAGACCATA
GCGTCTAGCCTGTTCTTTTGCAAAGTCGAAGAGTTTAGTTCTCTTCGAAGCCCAACTAAGCTTGATGCCTGTCGTCTGTCGAAACATACTGTCTCCTTAG
TGTTCCCTTTGAAACTGGGCAAATCGATCTCGAATTTGCCTTTGCTGCTGATCGAGTAGGTTGGCGACGAATGTGGCGTCTCCACTTTGCCCCGGTTCAC
CCAGCCGCTCGAAGAAGATTGCACGCACCAGGTCGGTACTGAGACGGAGATCGCGCTCGATGTCAGCGCGCAGGCAACCGACCGTTTTCTTGAATTGCTT
CTTTTGAAGTTGCTCCATGGGTCCGGACAAAGTGCTGCAGTCTTGAAGATCTTCGTAACTTCGCTTTGTACCAGTCTGAACTCGACCTGAAACGCGGCCA
TGAGGCGCCTCCGTACGCAGTTTTGGCCTCGGTGTGACCTCTGTCGAGACTTCTTCGGTACTCTCTTCACTCTCATCGGAGCTAGAGCAATCACCGAACA
ACGTCTGGTCAATCCTTTTCTTGGGTTTTCCATCTTCCGTGTCGGCTGGAACGCTGAAGATTTCGCCATTTTCTGGAGCTGGGGCTGGCAAAGTGCATCC
AGAGGAATCTACGCGCTGCATTTCGTCGAAAATGTCGTGGCTGATGTCTTCAAATTCTGCTGGGAGAGCGTACCAGTCTACACGCAAGCTTTGCTCGCTG
TCTGAGAGCTGGAACCACGTTACGGGGGCGTGGCGCTCGTTGAAAGCTCGGATGAAGAGATACGAGGCGGCAATGCGCTTCATTTTTCGCCAAGCGCTGA
AGGTCGAGTGACTCCAGGGAGTGTATAGCGTCGCGGACTCGTCGTAGCCCTGAGCCATGAAAGCGCTGACCAAAGTGTTTGACTTCTTCATCACATGACT
CCAAGACTGTACGAGAGATTTTACTTCGCACGGAGACCAACACGAACTGCACTTTGACGGGTGCTGAGCTTCTGTTTTGGGCTTGGATGCAATCGCTTTC
CGCACTTTTGCCCACTTGCGCACCGATTTCAGCTGGAGAAGCGTCTTGTAGGACGCCCGTGTAAGGTTCCAGCAGGTTTTCCTGACGGACGTAGGCATCT
CCACTCGGTTCCGTTCTTCTCTAGGCAGATCAAACCACAGGCGGCCACCGGCCACTTGCTGAATCTCGTTGAAGCGGTTTACAACTTGTACGACCTTGTA
GAGCTTGCAGCGCTGGCATCCGATACTGTCAGAAGTGCGACTTTTGTTGGTCCGCTGCGAGAGTTGTTCGGCAATGTGGCTGTTAATGCCGCCTCCACTC
TTCGTCCGCGAATGCATATACGCTGTAGGGTTAGATTCCAGCTCTCTCCACAGCTCAATCATTAGTGACACCTCTTTCTCGGTCCATTCCGGGTGGAGGA
AGCTCGGGTCGCTTCGATCAAAGACCCCCGCGGACTTCATCCTACTTGAGCAAGTGGTTCTCCCCGCTTGAAAAAATAAAAACGAGAAAGGGAACGGCGT
TGAACAACAACGTACGAGGTTCAATTCGAAAAGTATATTCCTAATGGAACGAAGATTGACTACACCTAGCACAGGTCCCCCCTCTGCTGGTCCTCCGATC
GGATCATTTTTTCTCGTGGTAACGCGGTCCAAGAAGCGCGCGGTTCTCAGCTTCTTCACGGGTCCGTTTCTCCATAAACTGATCAAACCGATCGCGGATC
TGCTGCTGCTGCATGTTCAGTACCTTGGTCACGAAAGCGACGTCGCCGCTGCTCTCCGGGTCCTCAAACTGGTGGCTGATGATGGAGCGCAGCATCTCCG
CGCTGCGTTGGATTTCGCTTTCAACGTCAGCACGCAACTTGCTCGCGGCTCGACGCATTTTCTTGTTCTGCAGCTCCATCATGTTGTCGAGAAGAATATT
GCAGTCGCGGTGCTTGCGTTTGGGCGGAAAGTCCAGCTCT