Description :
From Genome Similarity Track
Location :
Scaffold_5:5476888- 5483550
Transcript NameFunction/comments
Physo_353359unnamed protein product
Physo_304115spermatogenesis-associated protein 17
Physo_562292Major Facilitator Superfamily (MFS)
Physo_547279NIMA never in mitosis protein a-related kinase

Sequence
6662 bases(100 bases per row)
TGGCGATCTTCCATTGGTGAGGCAGTTGAGAAGTTTCCGAACAACGCGTTATTTCTTCGGCTGTTTGTCGATGCTGAGACGGGTAACACGATCTCCCAAG
TGCTTCGCAACTACTTCCTTCGGGTAGAAAAGCGCTGGCGGCGACATTATGATTCCCCGGAACTGGTGGAGTGGTTGTTTGCGCTGCTTTGTGAAGTTTG
CCGCATTGAGCGAGCTGCGACGGTCAAGTACCTTCCTGTGCAGTCAGACGATGACAATTGCTCTCGGCCAACGTGCTGCCTCTTCCATCGGTGGAGCATG
AATAGCACTACAGTCACTCGTATCCGTCAAATGTTTGAAAGTATGGTGAACCACATCCGTACAAAGGGTAATGCGCTATGCTGGAGACTGTATATGCGCT
TTGAGATTGCGCTCGGAAAGGTGGAGGCAGCGAAAAAGGTGTTATACCGTGGGATCGCAGCCTGCGCCTGGAGCAAAGCGCTGTACATGGATGGCTTGCG
CGTCCTGCGTCCGTATTTGAGCGAAGATGAATGCCACGAACTTCTCGAGTTGTTGGAGGCCAAGGAGCTAAATGTGCGAGTAGATTTCGAGTGACCAAAA
TTAGCAAAGTCAGTACTGCAGTGAAGGTCCAGATGCAAGAACGACAAGGAGACACTGAAGCGAGTGGGTGTCGTAGGAGGTTTGACCGAGCGGGTACTTA
ACGTGAGAATATATCGCCGAGCTTCAGGCCTCATACTGACGGATGATGGTTGTGATAGGTTACAATCTGATCGAGCAGCTTGCTGCGCTGAATGGCTCAG
AATGGAGTGTAGCAGGCATCTTAAACGAGGTTCTACCCGAGCAAAGGAATTTGTGGGAGGCGAGATGCTTGCTGAAGCCCGTATCATACGAGCGGAACAC
TCCCGACAGCAAGAAGCGCATTGTAGCGAGTATTCACGACACCAGATTTAAGCGCAGTGGTTCTGTGGCACCAATACCAGTAGCTGCCTCCAATACCTTC
GCGTTGGCCAACCCTTTCTCCAAGCAACCTGTCCTCACCGCCGATACTGATAATCAACCAAGCTTGGGCACCATCGGCAACAATTATCGTGGGCATATCC
TTACTCTTTGGGAGGACAAGTTCCGCCGAAAATGCTTGGCAGTGGAAGATGTGCTCTTCCTTCTTGCACGCCCGAATGTTGCTTGTACGTTAGAAAGCGC
GAGCTTTCTGCGAGCAACGCAGATGTCCTATGATCAAGTTATCGAGCTAGAAATGGCGCTAGCGATGCTTCGTGAACAAGGGGGGTGGTGCCATCCTCAT
CCTGATCACTCTCAAGCGTCTGCTGTCTCGCTGTGTGATAGACTTGCACAGAATTTATGGGTTCACGGTCGAACGTTGCCAATTTCGCGGACTTGCAGCA
GCATGCTCCCCGAGGTGATAAGAACAAAGCGTTTACCCGCAGTACGAGTGAAGCCCGTACGCAAACGTTACGAGAGACCAACAGTGCAACCCCGGCCTCA
ATTGGAAAATCAATGTAGCATGCTCAGCAAAGCAGGTAATCTCTACACAGCATCGAAGCCTACCAGTATGAATTCAGGCAACAATAGTTAATCGATCACT
GCTAACAGTGTCATTTTTGCCGTGTATGCAATAGCTGCTACAGCTCCGTCGATAAATGGTTGCCCACTTGATATTCGAGATTGGGTTCGAGATCACTGTA
TGGAGGAAGTTGTTCGATCCACTGCCATGAGGAAGCATTTTGCTGCCGAAAAGTTATTGGTATGGACTCCATACCTGTGTCTTTATTGGTTCGCCAAACT
CACGCTTTATTTACCCAGATATTTGTCCGCAGACACCTCCACCAAGTCATTCACCGGCGCTTTATGTATTGGCGCCAGCAAACGATGTGGATACAATGTC
ACCAACAGGCCCGCAGATTTTGCCGCCTGTACGTCTACATCTTCTACTTCCTACAGGGAATTGTAGTGACTAATTCGTTGTGTACACGGCTTGGACTGGT
AAGGAAATGCGCGCTATGGATTCTTCAAAGATCTCGCACAAGACTGCAATCTTTAGTCTTTCGTCTGTGGGCCAAGTGGATGGCTACCATAGCACAGCAA
CGGGAGTACGAAGCCATCGCTGCTGCTGTATACATTCAAAGTTGGTTTCGCGGAGTGAAAGGCAAGCAAGCTGCAGCTGTTCATCACCTACATCGAGCTG
CAACATTGATTCAAGCTCGTTGGAGAGGGTTTCTTTCACGAAAAATGTTCAAGCGGAGAAGACGCTTCTTGGCATACAACCGGGCTGCTCATCAGGTCCA
GCGCTACTACCACTCGTACCTTTTCCGCGTCCGCTGTACGGTTTGGAGGAGGCAACAACGTGCAGCACGTGTGATAACGCGTGCTTTCAAACATTATCTC
GAGAAGAAACGCGACTTCATCGCTTGGTGTCATCATTTGGCTCGATATCATGCCGCGATCTCCATTCAGATCTGGATGCGGCGAACGAGGAGAAGAATCG
CCCGCGCCAAAGCGAAGCGCGACAAACTGTCACGAGCGAGCCACGTGCTGTTCAATTTCTTTCGGTACACTCAGTTCATGCGGCGCTTTGGGACGCGCGT
GGAGACTGTATCAAAGCGGAGAACCGCTGCGGCGGTGCTGCTGCAGAACGCGTATCGGGCTAAGCAGGCACGAGCCAGATTCTACGAGCTGAAGGTCCGA
CTGGAGGACCAGCGACGCCAGGAAATCTTAGCGCAGATGTGGAACAACGCATACGCCACGACCATCCAGAAGTGGTGGCGGAAGCGGAGCAAGCTGCTGC
AAAGCAGCTTGAAGTTGAAGTAGACGTCAAGAGTGATGGTCACTTCAATCGTACTTAGGCGAAACGCCAAATCCAAAAGGTGATCTGACTCAGAGCCGCA
TCCTCCCCCCCCCCCCCTCGAGAAGCCATGGAGAAGAGCGAGCTGCGCGTGCGGTGGCTGGTGCTGCTGCTGTCGTGTCTGCTGATGATCGGCAACTATT
ACTGCTTCGACAACCCGGCGGCGCTCAAGAGCCAGCTGCAGCAGCACTTCAACACCATCCCCAAGGACCGCTACGAGTTCCTCTTCGTACGTCTTAAACC
TGAGATCTTGCTGCATGCTAGCGACAAATGTCGGCATTTGCTGGGCGGTACAGAGAGTATTAACCAATTGCACATTGATATTACCTGCAGAACTTGCTGT
ACACGTTGTACTCGATCCCCAACATCCTGCTGCCGTTCTTCGGGGGCGTCTTGGTGGATCGGTTCGGTGCGCGGGTGATGCTGTTCACCTTCTCGACGGC
AATCTTGACGGGGCAGTTGATCTTCGCGACGGGCTGTTCCTTGTCGAGCTTCAACTTGATGCTGGTAAGCCAAACGTTGTCGTTTTGTGTTGGATGTTAG
TTCAACGGAACTGACAGTTTTCTTGTTGCATTTCTTCAGTTTGGTCGCGTGGTGTTTGGATTTGGCGGAGAAAGTCTCGGTGTGGCTCAGGGAACGCTCG
TCGCTTCGTGGTTCAAGAACAGCGAACTTGCGCTGGCATTGGGCATCAACCTCAGTGTTGCGCGGCTGGGGAGCGTCATCAATAACGAACTGAGTCCTGT
TGTCTCCCAAGCATCAAGCGTTTCCACGGCACTGTGGGTGGGCGTGATCATGTGTCTGGCGTCTACCTTCATGGTGCTATTGCTGATACCAATCGACAAA
CGAGCGGAAAAGTTGACGAAAGAGAACCAGAAAGAGGCAGGAGTGGCTGCTGAAAGCATCCACTTCAGTGATATCAAGCATTTCCGCCCAGCTTTTTGGC
TCTTGGCGCTGAGCTGCCTGGTGGTTTATGGCTGCGTGATCCCGTTCAACAACGTCGCGAGCAGTCTTCTTATGGAGCGGGACTTTTTCAAGGAGCCCCC
TGAGCTGTGCCGACGATGCGGAGAAGGGCTTTACGATTTCGAGATCGATTGCGCCGAGATTGTACCGGGGTGCCCCAGTGTTCCTCCATACGGGTGGCCG
TTACCGTTGTTGTCAGCGAATTGCACAATCAAAGAGCCGCTCGATCAATGGAACTGCTCGACTTCCCCTCCGCTAATTGAAGGAGACAAGATCAATTGCG
ACGACGAAGCTTGGAGGCTTGGACCTTTTACGCAGACATACTGTGCCACGAAAATGGATGCGGCCCAGAAAGCTGCAACTCCGATGTCCATCCCGTACAT
TATTAGTGCGGTCATCTCTCCGTTCCTCGGGTTTGTGGTCGACCGAATCGGTCTTCGCGCGTTTTTGGCGCTAGTGGCTCCGGTCGCGCTGACCGCGGTC
CACGTCATGCTCGGACTGACTCAGGTAAGTCTCTACGTGCCGCTGGTGCTTCAAGGCGTCGCCTACAGCGTGTTCGCCGCAGCACTGTGGCCGTCCGTTC
CGTGTAAGTACCCGATGGGTTGAAGTGGTTGGGCTCTATGAATCTTCACCTTGTTTGGTTACTTACTTCATTTGCGTTATTTGCGTTTGTGCAGACGTGG
TGGAGGCGAAGCACGTCGGTACTGCATATGGAGCGATCACTGCGATCCAGGTTTGTACAATGGCTGGGCCATGCGGCATTTGAAAAATCTACTCGATACT
AAGCAAATGCTTGCGTTTTTCGGTATCTGTTTGCCACAGAATATTGGGCTCGCACTATTTCCGCTGGCAGTGGCTGCTGAGTTCAACCACGATGATCGGT
ACATTCCTGGCGTGGAGTTGCTCTTCGTGTCGTTTGGCGTCTTGGGCAGCCTCGTGGGCATTGCGCTCAATGTGGTGGACTACCAAAACGGGTCCATTCT
TAACCACACAAACGCCACGAAGAGAAGGGTCTCGCTCATGTTGGACGAGGACGCCCTCGACAACGAGGCACTGCTGGCTGCGGAGCACTAATCTGTGTTT
GCATCTACATTGTGTAAAGCTTCTCTGAAACTGAAATACAAGAGCGGTATTATATTGACATTCGACGAGTAGTCTCGACTGAGTTCGTTCTTTAACCGTT
TTGTGCGAACTGAAGCTGGTGAGCTTCGCGTTGTGATGAAGATAGCAAAACAACTTACGAAGCAAAGCCGCCCTAATATTGCCGTGACTTCGCTAGACCA
CTACTTATGGAAGTGCGATGCATCAAGAGAAACACTCCAGAGAGTCCGTTATCGATAACGGAGCCGTACGAAAATTGCCGTTTGAGTAATCGGTAGTGAC
TGAAGGAGTATGCACATGAAGGGATAGTAGTACGGGACACGAATGTTGCATCGCAGTAACTTTTTCGATGAGGCTTTCGAGACCATCAACAACTTTGAAG
CCCTACTACCAGTATGAGTTGTACAGTGCCTCTCACCCGCTACGTATATAACGATTGTGGTGCCAAATGATCTAGGTTTGACCAGGTTGCACATGCACTA
CAACCCCATCCGCCTCAACAGTCATCTGAGGCGTTCCGCAACAACGCCACCGGTCTTACGAAACATGGAGCGAGGCGTAAATAGCTACACGCCGATCCTC
GGCACGTAGACACACCTCCATTCCTTACGAGGTTTTTATGCATAAGCGATTGGAAGTAAAAGTACGTTGGTGCATACTTACCCCGTTCGCTGCGGCAACG
TTTAACCCAAAGTTCCTCTGCTGTCGGCAACGTTGCGGTCACAATTGCGGTGCGACGGCCAAAGTACAGCGTTTGTGCGTTTCAAATGCAAGCTATCGCG
GATCGCAAAGCGCGTAGCCATTTCATTTTGCGGCTGCATCTTCAGGCGTGTGAGGCCCGCTGGCTGCTCGGGAGCCCGATGATGATGTACTGGAAACCAG
GGTCGACGCGTTGCAGCCGCAGCATATGTGTCCGCGCTCAGAGCTCGAGGCGAGACGCGATCCGCGCCGCGCATTTCGGGTTATCTGTCGGGCAGACGAA
CGAGCAGCGATCCCGACTTTCTCTTCCGCCTCTTGTGTTGGCTTTGCACGGCAACGATGGCCGTGGCGCGGCTGGCTTTTTGAACTGACTTGCCTATACC
GGTGAGCCAATGAATCCGGGAAGTCACGCGAACGGTCACGGCGGCAGTACCGTGGCGGTGTGGCGTTGTAAACAGACCGTCTGAAACGACAGGAAACGCC
GGATCATTGGTAACGCGCCATCTCGGCGTGCAATCCCCCCCAGCAACTCGGCATTTGGGGAGCCAACATGCACTACATTGAGGTACTGGGCGCCCTGTTT
CGAATGCATGGAAGACGTCTACCCGCTGACATTTTTTTCTAGGCATGCGACCTCTCGGTGATTTACCACATCTCGTCCTTCCTCGCTTAGAATCGTGACT
GGGTTTCAGTATGCTACGTGGAAAAGGGGAATTAATAGTTGGCTACCGGGGAGTAACAAAGGGGGGGAGAGTTGGCTGGCGTTTGCCGCGCAGATAAAAG
CCCACAAACCGAAGAACAGCGAGAGGAGAAGACGAGTTGGCGGGCGTCGTCAGTGTCGCTCCTTCCGTCGCGCTCTCTCCGGTCCCTCGCGTTACCCGAA
GGCACGGCCATTGCCCCCTCCTCCCTGCGCGGAGAAGACCTAACTCCCCTCCACAGCCACAGCCGCAGCTAGCCAGCCGCCATGGACGCCTACGAGCAGG
TCCGCATCATCGGCAAGGGCTCCTTCGGCGTCGTCACGCAGATCGTGCGCAAGTCCGACCGC