Description :
From Genome Similarity Track
Location :
Scaffold_11:54755- 58044
Sequence
3289 bases(100 bases per row)
CATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACAC
TCCCGTGGAGTTGGTAGTGGCTGCAAGGGAGCCTGCGCGAAAGGCGCAGACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATT
TGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGAT
CCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCATTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGT
GCACGAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCAAGCAAGAGCTTCGCGTCCACGTCGTGCGCGTACG
CGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACG
CGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAAGGAGAGCCATCTCGCCATCCGTTGCGAG
ATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCATATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCTCGAGTGCGT
ACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTGGTTGCGTTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTG
ATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCC
GTCAAGCCCTGTTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATAC
TTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGTGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGC
GGACACCGTTTTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCAAGCAGCTTTCGGAGGTGCACCTTGTGCTTCTCAACATCG
CTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGA
AGGTCGCAGGGGTGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACG
CATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGAGGTATCGGTGTC
TGCACCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTATGGCTTCTTGATACAGAACGTCGGAGCACTGTGCGGGA
ATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACA
GTACTTCGTGCCCGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTACTCCCGTAAGATCT
CGTAGAAGGGACTCGACTTCAGCGAGTCCCAGCTCTGCTCCTCAATGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCACTCTCAGTGGTGCTGTC
CATGAAGAACTGCCTCAGTTCTTCATTCTTGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCAAATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCG
AAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCTGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAATCCGGCACGGGTAC
GCGTCAAGACGTTCAACGTCTCGACGCCTGGCTTCTCAACCTTCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCGGGCCGAGACTTGCGCAG
CGACCTTCGCATGCACCGTCTTCTTGTTCTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTGTAGTA
CCGCCGGCGAATACATTCCGCGGGCAAGCGACTTCAAGCCCGGCTTGACCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTT
CCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGCGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTCTCG
TCACCTTGGGTTCTTATTATTGGCCAAAACGGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGACGTGCGACTCGCCTGCGTCATCCGCGCCCCTT
GAGGTCGGAGACTCTTCCCGATTCGCTGAAAAGCGAGTGTCGACATCCGAGGTCAACACATTTTCTTCATTAGCCGTCGGCGGCGACGCTGACGCTAGCT
GCTCTTGCGCGCGTGCTCGCACGCGCCCAGAGCGCTCCGGGACAGCGGCATTAGGCGCTGTCGCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGT
AGCGGCAACAGGGCCACCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATGATGCCGTGCAAGCCAC
GGCATGCCCAATACAATGTCAAACTTACCGTTCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGC
GCTTCTCGGTTTTAACGATGGCACCCGTTGCCGATCGAACTTCCAACATACTTCGAGATGTAACTATCTCCTCGAAGTCAAGCCTTGGTAGACTTCGCAG
TCGAACAAAGTTGTTCGACGCGCCATAATCTACCAAAGCCCGGAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGT