Description :
From Genome Similarity Track
Location :
contig_128:54745- 57708
Transcript NameFunction/comments
g13578.t1hypothetical protein
g13579.t1ETO60996.1 hypothetical protein F444_20900, partial [Phytophthora parasitica P1976

Sequence
2963 bases(100 bases per row)
GCTTGTTGCTCGGCGTGGTCCGGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGGGGTCGCTGCGAGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCGT
GACAGTGGCCGCCTTGACAGTGGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCCCCTGCTGCCGGCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCTG
GCGCACGCGTGTGCGTGGTTTGCAGCAGCCAGCCTCGACGCGAAGGGCACACCGCACGCACATCCCGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGGT
GCCGGGAGTCCCGGTGTCGCTTGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCACAGCGTGCACTGGAAGCGCTGCGCATTGTGCGCGTACACGGAGAG
GACGGAGGCCGGGCGAGCGCTGGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCCCCAGCCTCGTCCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCGG
GTGTCTTCGTCGTCGACGTCGTTGAGACGTCGACGCTTGCCGCCGACGCGCTGCCATGGCGGCTGCTGTCGGCGGGCACCTTGGTCAACATCCATGGCGA
CGACGCCGACGTCGCCTGCTGCATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCCGCTCGCGTCCGTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGTC
GCCCGACATGGGCTCCACGCGCGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGCTCGGCGCGCGCGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGGT
GGCAGGGGCAGCTGCGACTGCCGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGGCTCGGCGGCGGAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCGG
CGAGCATGCGCCCGCCCTTGCGGGTGAGGGCAGCACATTCGCGGGGGATTCGGGGGCCGGCGGCCCGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGGC
GCCGCGGCAGCAGCGGCTGCGGGCGTCCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGAGGTCGTGGC
GGCGGCTGGCGGCGGCGGCGCGGTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTCGTCCTCCAGCTCGCTGGGGCCGTACGCGGCCGCGAGAGCGCGAGC
CGTGGCGGCTGCTAGCACTTCCCCTGGCACGACCGGCTCGGGCAGCATGCCGCTCGCCCTGCCGGGTCGTGCCACTTCGCAGGGGGGGAGCTGGGGCGCG
GCGACGGGCGGAGAGGCGGGCGAGGGACCTTGGCCAGCCAACGGGCGCGCGTGGGGGGGCGGCGGACGTCTGGGGCCGTCGTGGCGGCCGGCGCTCGGCG
GCGCTTCTTCGGCGGCCGGCCGTACGGGCTGAGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCC
GAGTGGGGAGGGGTGCGCCGACCTCCCGCCCGCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAG
GTCGTGGAGGCGGGGCGGGGCGTCTCTTGGCCGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCG
AAGTTGCAGCCGCTGAAGCGTCGCCGGTGCCGAGCAGCGGCACCGCGCGTGGAGGCTCTCGGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCG
AGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGTCCACTGCGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAG
ACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTCGGTGGACAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGAT
CCTATTGGTCAAAAAGGGTAAAGGGACAATGGAGGACGCAACGCGGACCGAGGAGGACAGCCGAGGAGGAAAGGTAGGTAGAAAAGAGTCAAATGTAGTT
GGCCTCGCGGGGGAAAGGTGAAAGCCCCCGGAAACCGTCTCGCACAGCAAGCGCCACAAGAGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTC
GGAAACCAGTTTTCACACTGATTAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAGGTATGATTATCGTTCTAGATAGAGCTTTCTCCTTA
TAGTAGTTTAATACCCTCACGAGCATGTGTTTGTTTAAGTATATTATTATTCTCTAATATATGGTAAAATAGCATACCTATCCCCCTACCGGTTTTTTAA
GAGTGATTCTAGCCTTCTAAGAAATTAAAATTGCGATTATAGTCTACATTTTCGGTAGCTGGGCTGAAGTGCTGCCAAACGATGCACCGCAGCTCCTTCC
TCTTTGCAGCTCGAAAGTGCTGTTCCAAAACCCCGTACGCTATCAAACTACACATTCCTATGCAGTCAGCCCGAATGCAAGAAAGTCAACCCCTGCATCG
CTCGCTAGTCGCCCGCACGGGTACCTTCCTTAATAATCACAAACCAATCAGACGCCTCGTTCCTGCCAAACAGTTTCAAGCAGATGTCGGAGAGAGCGGA
GCGACTCTCGGGCCTGCAGAATGGCGTCGTGGGCTCCATCGCCGGCATGATCGAAGTGATTCTGCAGCAGCCTACTGTGGCCATCAAGAACGCGGTACAG
CAGGGCCGCCCCATCGCGTGGTCCGCGCCAGCGCTCTACCGCGGCGTGGGCGTCTCGCTGGCATCCATTGCGCCCGTGAGCGCCATCCAGTTCGCAGTCA
ACGGCCGGTTGCTGCGCGGCCTCACAGCCCGGGCGCGGCGCCATCAGACCAGACGAAGGTCCT