Description :
From Genome Similarity Track
Location :
contig_128:54739- 57702
Transcript NameFunction/comments
g14102.t1hypothetical protein
g14103.t1OWZ14690.1 Mitochondrial Carrier (MC) protein [Phytophthora megakarya

Sequence
2963 bases(100 bases per row)
GGCTTGTTGCTCGGCGTGGTCCGGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGGGGTCGCTGCGAGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCG
TGACAGTGGCCGCCTTGACAGTGGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCCCCTGCTGCCGGCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCT
GGCGCACGCGTGTGCGTGGTTTGCAGCAGCCAGCCTCGACGCGAAGGGCACACCGCACGCACATCCCGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGG
TGCCGGGAGTCCCGGTGTCGCTTGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCACAGCGTGCACTGGAAGCGCTGCGCATTGTGCGCGTACACGGAGA
GGACGGAGGCCGGGCGAGCGCTGGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCCCCAGCCTCGTCCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCG
GGTGTCTTCGTCGTCGACGTCGTTGAGACGTCGACGCTTGCCGCCGACGCGCTGCCATGGCGGCTGCTGTCGGCGGGCACCTTGGTCAACATCCATGGCG
ACGACGCCGACGTCGCCTGCTGCATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCCGCTCGCGTCCGTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGT
CGCCCGACATGGGCTCCACGCGCGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGCTCGGCGCGCGCGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGG
TGGCAGGGGCAGCTGCGACTGCCGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGGCTCGGCGGCGGAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCG
GCGAGCATGCGCCCGCCCTTGCGGGTGAGGGCAGCACATTCGCGGGGGATTCGGGGGCCGGCGGCCCGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGG
CGCCGCGGCAGCAGCGGCTGCGGGCGTCCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGAGGTCGTGG
CGGCGGCTGGCGGCGGCGGCGCGGTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTCGTCCTCCAGCTCGCTGGGGCCGTACGCGGCCGCGAGAGCGCGAG
CCGTGGCGGCTGCTAGCACTTCCCCTGGCACGACCGGCTCGGGCAGCATGCCGCTCGCCCTGCCGGGTCGTGCCACTTCGCAGGGGGGGAGCTGGGGCGC
GGCGACGGGCGGAGAGGCGGGCGAGGGACCTTGGCCAGCCAACGGGCGCGCGTGGGGGGGCGGCGGACGTCTGGGGCCGTCGTGGCGGCCGGCGCTCGGC
GGCGCTTCTTCGGCGGCCGGCCGTACGGGCTGAGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGC
CGAGTGGGGAGGGGTGCGCCGACCTCCCGCCCGCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGA
GGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGCCGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCC
GAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCCGAGCAGCGGCACCGCGCGTGGAGGCTCTCGGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGC
GAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGTCCACTGCGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAA
GACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTCGGTGGACAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGA
TCCTATTGGTCAAAAAGGGTAAAGGAACAATGGAGGACGCAACGCGGACCGAGGTGGACAGCCGAGGAGGAAAGGTAGGTAGAAAAGATGCAAATGTAGT
TGGCCTCGCGGGGGAGAGGTGAAAGCCCCCGGAAACCGTCTCGCACAGCAAGCGCCACAAGAGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGT
CGGAAACCAGTTTTCACACTGATTAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAGGTATGATTATCGTTCTAGATAGAGCTTTCTCCTT
ATAGTAGTTTAATACCCTCACGAGCATGTGTTTGTTTAAGTATATTATTATTCTCTAATATATGGTAAAATAGCATACCTATCCTCCTACCGGTTTTTTT
AAGAGTGATTCTAGCCTTCTAAGAAATTAAAATTGCGATTATAGTCTACATTTTCGGTAGCTGGGCTAAAGTGCTGCCAAACGATGCACCGCAGCTCCTT
CCTCGTTGCAGCTCGAAAGTGCTGTTCCAAAACCCCGTACGCTATCAAACTACACATTCCTATGCAGTCAGCCCGAATGTAAGAAAGTCAACCCCTGCAT
CGCTCGCTAGTCGCCCGCACGGGTACCTTCCTTAATAATCACAAACCAATCAGACGCCTCGTTCCTGCCAAACAGTTTCAAGCAGATGTCGGAGAGAGCG
GAGCGACTCTCGGGCCTGCAGAATGGCGTCGTGGGCTCCATCGCCGGCATGATCGAAGTGATTCTGCAGCAGCCTACTGTGGCCATCAAGAACGCGGTAC
AGCAGGGCCGCCCCATCGCGTGGTCCGCGCCAGCGCTCTACCGCGGCGTGGGCGTCTCGCTGGCATCCATTGCGCCCGTGAGCGCCATCCAGTTCGCAGT
CAACGGCCGGTTGCTGCGCGGCCTCACAGCCCGGGCGCGGCGCCATCAGACCAGACGAAGGTC