Description :
From Genome Similarity Track
Location :
Scaffold_1315:5473- 7273
Transcript NameFunction/comments
Phyag_g10258hypothetical protein PHYSODRAFT_299126

Sequence
1800 bases(100 bases per row)
TGCAaggcacctgcagcagtcgccccgttgctccttcttggccacgacaAGTCTGATAACGTGCGTAATGGGTTCGTAGCGCCACGTAGCGTTTGGCCTG
AAATCTTTAGAAGAGAATGGCCCCGACGCTAGAAAGTTGTTGGTAGAACGGGTTCTCCATCTACAGCTCTATCTTGCGACCACCAATATGCACAGAATCG
CCGTTTCGAATATGACTGTGCGACGCTGGACAAACCATGCCAGATCGGATCGCGTTCCAGTATGGGCTCAGCTGATCGAGTAGTTTTGGGGCTGCCTAAG
ACTACTCTCCGCAAAGCGTGCACCGAAAGGAATGGCGAGAGATCCAGCATCGAGAGATAGAGCTACGATGATGTCGCGGAGTAACGCTTTATCTGCATGG
CCCATTTCGCCAGGTTAGATTTGCTTTCTGGACTCGCGTGGCGGGTGGATATTCTGTTAAAATTTACCAGTGCTTCTCTCTGCAACGCGCAACTCGCTGC
GCATAAAGTTCACTCTTCCCATGGCTATCGTTTGCTGATACCCTGACGAACCTCGCACACCCAAGCGGAAGCCTATAATCACTGAGACGAATGAATGTGT
ATCGGATTCCCNAGTAGGACGTATTTCGACTCAAGCCGCTTAGCTGTAGTCCCTGTAGAAGGCGCATTGACGACAATAAGACTACTGAGAAATGATGTAG
CGATGCATCCCTGCCAGACCATACATCTTGAAAGACTGGAAGCAGCGGCGTTGTTGTCACGATAAGATGATATCTGAAGTCGAAAATTTATGTTATCCGA
GCGTTGACACGGCAATGAACTCAACGAAAAGTGTGTTTCACATGAAGAGCGTGCATTGGAAATCTCAGTAGGACTCAAGCTGCAAATGACACTTCGCTAC
ACTTTTCACTGCAAACACAGCACACTGCCGAGTGCACCACTTGCAATATCGGTCCAACATCAAAACCAATCGTAAGCCTCTTGTATCCGTGTCAGCAATC
CAGTCCCGCCGCCGATACCGCCGCATGAAGCAAACTCAAAGCCACTCAAAGATTCCAACTTCCGGTCTGCGCCTCGATCTTGTTTCGAGTCGAGCTGACT
AGGGTCGAAACAGCCCACCATAGTCAAAAACTCGCTTGGGGCTGGAGCGTCATGCAGCGTAAATCCATCACGACCAATCGTATTTGgacccaccaccaca
aacGCGCGCTTGAGTGCCTTGAGATCATCATTACTATCCAACGCATCGTTCAACTTACGAAATCGATGCGgtttgaacttcttctccttcgcagCAGTGA
CGTGAACATAAATTAAAATCGTCTCTGGTTTTGTGCTACCAGCCCGAAAGGCTTGGCACATGGTCACTGCATCGATGAAAGGAAAGGGGTAATCGGGGTG
CCAGTAAGTGTTTTGTCCGAGATTGGCCAAGCGCGTGTAGCATGCGTCTTCGTTGTCACCACCGCATTCAAACCTCGGACCGCGTATCTCCAGTCTTTCG
TATTCAGACCCGGCGCGCATCGTCAAAACAAGCGGCGATGTTTTCTTATTGGCTTCATGCACTGCACGGTGCAGCAATAACTCGTATGCAGTGCCCAAGa
atccagcaccaactgctCGCGCGTACTTGTACACTTCCAACAGCTTCTCCGTGGGAACAAGCTTTCCTAACACCTCCAATGCATACCCAGAATCCACAGA
GAGTTTCCACCAAATTGCGTTTACGTAGTGTTCTTCCTTGCTTGTATCAGTGATGTAATGACGACGGATTCGGTCCATTTGGTTTTGGCTCCTCCCACCT