Description :
From Genome Similarity Track
Location :
scaffold_708:5473- 6908
Transcript NameFunction/comments
g9959.t1hypothetical protein

Sequence
1435 bases(100 bases per row)
TCCACGTCCCTCTGATTATTGTGCCGGTGCCTCCCCACACCCTCACCACCGGTGCGAACATACTGCAATTCCAACTCCAAATCTTCGTATTTGCACCTTA
TTTCACGTTTCTCAGCCTCCAGCCCTCCATTCAGCCGCAGTAGCTCCGAGACACGAGCTTGAATCGCTTCCAGTTGACGCATAAGGTCTTCATTGAGTGT
CTTGGTCTCACTAAGCTCAGCTTGCAGCAGAATTTCCCTCTCTTTTGACCCAGTAGCCTTCATAGCAGCCTCTAGTTGCCCCATGAGCAAACGTTCTCGT
GTTTCCAACGCATCAACACGGCTCTTTAGCCGACCTACCTCGCTTTGATTACCTCGTTGCTGTCTGAGGTCAAGCGACGGAAGTTGCACTTGATTATCCT
CCAAGTCTTTCTCGAGCTGCTTACGGCGCTGCTGCTCAACTTGAATCTCGTCTTCCAGAGCATCTAAACGCTTTCTGAAAGCCTCCCACTTCGTATTCCG
AGCTGTCCAGTCGCGCTCATTTATCTGCACTATCGCATTCTCCAGGACTTGCACCTTATCGCTTGATTTCTCTCGGATTATAGACAGATCCTGGGCCTTT
TTCTCCATCTCCAGCTCGAGTCGTTGATTCTTCAAGAGCGTTTGCTGCTGTGCTTCTGTGACCAGATCGTATTGCACGAGAAACTGCTGATAAGTAGCCT
TAATCTGCATCAACTGGTGTTGAAGCTCTCCGACGATTGCGTGATCTTCCGACGAAGCCATCAATTCGCGAAGCTGTTCTACTTCCTGCTCTCGATTTCC
CTGCTCCTGAGTAGCACGTTTTGTCAAAACGTTAGCCTGGGACGCAGCAAGCGAAGCGATATCCTTGTACTTGGCGCATTCAAGCGCGAGGCTCTCATAC
AGCTGCTCCACTTCGTTGATTCTCTCGTACAAAAGCTTGTTTTCATTTCGCAGCTCGTTGTCCTCCCCAGAGTCTTCGTTGGTCACTGGTGATTGTCCCA
ATTCATCTTCGTGAAATAGTCGCTGATAGCTAGCTTCTTCAAGCTCCTTCACGCGTTTAATTTGCATGTTCAGCTCACTTTCTAGTTGAGTTATCCGACC
TTGCAGAGCTCGTGTATAACTACCCGTTTCCCCAGCACCTTTGGCGCTTATTTCTGCCCGCAGTATCGTAACTTGGTGTTGGGCTAGCCTCAGTTGAGTT
GGCAACTCGTACAGCTCCAGATACTTGGCATGCATCTTGGCATAACTTTGGTTTACTGCGTTGTACTTCTTCAATACAGCAGTCATGGCCCGTTGCTGTT
TGTCAGCAAACTCTCGTAACACACTCTTTTCCAAGGTTTTCTCCATGCGCTCCATCATCTCGTCAGCACCCTGCTTCCACGTTTCAAGGTACAACACCCG
GTACTTGAGTGTCTTTTCCATCTCGCTCCACTCAC