Description :
From Genome Similarity Track
Location :
Scaffold_88:54727- 73440
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18471hypothetical protein
Phypa_INRA-310PPTG_18472hypothetical protein
Phypa_INRA-310PPTG_18473hypothetical protein
Phypa_INRA-310PPTG_18474hypothetical protein
Phypa_INRA-310PPTG_18475hypothetical protein
Phypa_INRA-310PPTG_18476hypothetical protein
Phypa_INRA-310PPTG_18477spindle assembly protein

Sequence
18713 bases(100 bases per row)
TTGCAACTGTACTTGACCACTACAGTGACCCATATCTGACAAGTAGATCAACGAGACGACGCCGCTGCGTCTTGCTGTCAAGATCAACCGCCGAGATATC
GTACAGGACCTGCTGCTCGCAGGTGCCAATCCACTACTCAGCAACGCATAATATACATTCAAGTATTGTAATCCTGCACTTAAACCCCCTCGTCACTTTA
CTGCTTCAGTTCAGAGGCCAAACTGCTCTCCAGTTAGCCATAAGTCGCGGGTTAAAGCCCATCGCAACACTCCTCCGCCAAGGCGTCAAAGCCAGCAAAC
TCTCGCCAGCCTCGAATCTGCAGTCCAGCAAACAGCCAAATGTCGACAATGCCTCATCGCTAGTAAACCTATACAGTCCAACAATTAGCATTCTTACCAC
CCTGGCACTTGCATCTGGTAGCATTAAGTCGACACATGTTCATTTTATCTTGTTGTATCTTGCATCTCTGGACCTCCCACTCAGAATAGCGGGTCGTCCT
TCATGGGGGCACTGCCACCCTTGAGCGATTCGGGGGCGGAGAACAGCTGGTCCACCTTGGATAAATCGAAGCTCTCGAGTGCCTCTCCATCCGGGTCCAC
GGCTGGGAACACGCCGGTCGTGTCGTTTCTCTTCTCGACGCCGAAGACGGGCGGGTTCATGACGCTCACGGCGTGTAACTCGTCGGATTTGGCCTCGATC
TCGATGGCCTCGGCCGCATTAAGCGCCACCAAGGAGCCCTCGGCAACATCCTGGAACTGACCGGGGCCCTCACCCACGTCCAGTAGCCGGACGCGGCCAT
TGCCGCGGGTCACCAGCAGCGCGTACACGTGGTTCTGGAACTCAAGGCGCACGGGCGCGCCCTTCTTGAGCACTTCCTGCTGCACGGAGAACCCGCACTC
GTCGTTGCGGACTAAATAGCGACTTCAACAGGGTAGAAACAAGTATGATGGTCAGTTTTTTTTATAGATACGCAGTTGATGACTACACGTGTCCGTACCG
CGTTTCAAGCGCACCGTCATCGCTGGTGATGACGCGGTCCTTCTGGCGAACGTCGTCCAGCGAACGCACGAGGAAGGACGAGGGTGCAGAGGCGTGTAGG
GAGCGGGATAGCGGCTTGAAGGCCGTCGCGGTTTGAGTCAATAGCCTCAACATGATGAGGACAAGTCGAGCAATGAGATCCGCAGGAAGAATATGCCCAT
CTCCTTTCATTACTCGTACTTAGTCGGGGTTATCGTACTTAGTCGGGTGATAAAACTGCATTATGTCATAAAATGTAGCAATCAATTCCTCACGTCCTGT
TCAACGTCATCGCGCCTTTTCGCACATATTATTGTCCAATCATAGTTCTCCATAGCAATGTTCTTTCTCGAAACTTGCGTTCAGTATCAGAGCATTAACC
GACAGAGAACCATGAAGGAGAGCTCACTTGGCGGCGCGTGCGCAGGCCAGGAGGAGCCTGCACCGCCCTCTACGCGCATGCACGGACGTCAACTGGCGTG
TTTCCGCCCGAAGCGCCGCTTTCGGCTTGCAACGGCTGCTCAGAAGACGGAGGACGTCGAGCTGGCGTGTCATTGTGAACACCAAGTGCTGCAATGTCTT
GTGGACATCCAGCAATACACGGAAAGAGAGCTGGATACCGCCGAAGACTTCCACAAAAATCGTATGCGTAAGTGGAGCGAGCGCTTCGTCACCCGTGACT
GGGCACAGGAGCGTGTGTGTCAAAAGTGGAAGGAGAACCAAAAGCGCTTTACAGAGCAGGAAGAAGATGCACTGGAAGAGGACTTAAGCAGCACCAAGGC
TACAACCAAGACGGTTAAGATGGCGTTTTCTACGTTTGCCACGGCGGCAGAGCTAATGCTGCATTCGCGCCAGTTCGACGCGCTGTTGAAGGCTGGTGTG
CCGCCACATCTGCGTGGACAGGTCTGGTGGATGTGCAGCGGCGCAGCGGAGCTTCGACGTGAAGCCAAGGAGTCGTATCCTGCGCTACTACATCGACTGC
ATACACTGAGCAAGTGTGCGGAGATGGATATCGAGAAAGACCTGCCAAGGACGTTCCCTCTTGCGCTGCGTAACTCAATGCGCCAATCGCAGGAGCTGTC
AGGAGACAGCGACAGCTTTGGCGAGCTGCGTCGTGTACTGCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAACAGCT
TTGGACCAGTTCGCAGGGCATACGGCAACGTCTCGAGCTTGGCCTGCATCTTCTTGTCTGCCGCTCCGGTCGCTCGAAGCGCAAGGTTGGCGATAGCAGG
GAACGCCCCCATACTGTGCGCATACAGACAAATATCCGACACGGATGCGTCCTTTTCGAGGGTCTGCAGTACAGCAAACAGGTCCAGCGATTCGTTCCAG
CCCATGGTCACATAGAGACCGTCCGACAGCCCAGAGCCGCAGCAGTCGAAGGCCAGTACGGAGAAGCCGCGTTTTAACGCTGCATCACGCACACGCAGTG
CATCCAGTCGAGAGCCAATGTTGGAGTGCAGGTAGATCAGACACGGCGTGACAGCCGGGGTGCTGCTGCCCTGTGCGAAGAGCTGCCAGTGCGAACAGCG
CACACGCAAACCCCGCTCATTGAGCACGTCGAAGTCTCTGCGTCTGGCCTGCGTCACGTTGTCCTGTGTGGGATCTACCGACAGCTCGGCGACCTGGAAG
CGCTCGGGGCCCAGCTCGTGAACGTCGTACAGCGCTCGCTTGGGGCGGATCACCAGCTGCACGACGTCGCGGTAGCCTTTGCCCAGCAGCTGCTTGACAC
TGGCGTCGCCTGTACCGCCGAGACGCTTGAGTTCTGCCTCCAACTCGCCCTCGGCGAAGATCTCCATCTCGGTAGACACGCCGTTGCCCATAGCACCTAA
ACGTTTCCTTGCTGTGCTCGTCTCGAGGAAACGCGAATGCCAGGCGCTGACTGAGACCGCGATGGGAGACTTGATGTTCAGTTGACCAAAGTGGGACCGA
TCAGATCTGTTTCTTTTGTTAACGAATTTGACAGGCCTTGATGGTGATTGGTTGTAAAAAAAATAGTCGTGATGATGAATGGTGAAATGGAAACGTTGCG
TAAACAAACACCACTTTGCATCAGTTTGAGTCAAACAAACTTTTCAATTTGACAGGACATTCAAGCTGCATTGAGATTTCAGCGTGGAAGAGGAGGCCTG
AATAACAAATAGTAGAAGCCAGGAAACTCGATTACATTTTTTTTGCTTTGAAATACGAGGATACAGAAATGATCGGTAAAATGCCTGGAAAACAGCAACG
GATATTACTTATTCGTGATGAGGGATTGTCGACGCTTGGCTGTTTGCTGGGCTGCAGCTTCGAGGCTGGCAAGAGTTTGCTGGCTATCGACGCCTTGGCG
GAGTAGTGTCGCGATGGGCTTTAACCCGCGACTCACGGCTAACTGGAGAGGAGTTTGGCCTGTGAACTGAAGCAGTAAAGTGGTGAGAGGGGTTAAATGC
AGCGCTTACGACAATAAAATGGGGTGCTGTACGTTGCGGAGTAGCGGGTTTGCACCCGCGAGCAGCAGGTCTTGTACGATATCTCGGCGGTTGATCTCGA
CAGCAAGATGCAGCGGCGTCGTCCCGTTGATCTACGAGAAGAAATTGGTCACCACAGTGCTTCACAGTCTAGTACGGGTTACATACTGCGCTTACCGTCC
GCGCGTTGACGTTGGCTCCGGTAAAGAGCAAATGCTTCAGTAGTTTGGCGTGTCCGTGCTGCACTGCAACATGCACACTTGTCTGCTGCCAGAGCTATCA
CAACGTGAGTTCATCCTGGATATATAATATGCTTCAATACTCTTTACATACTCCATGTGGAGCATTGACCTGCGCGGCTCCACTTTTCGTCACCAGCAGC
TTCTGAGCGGCCACAGTGTCGCCATTATAGATCGCGTCCCAGAGCGGCAGACGCTTGCCACCTTCCGGCCAGGACATCTCAAAAAGATCTGCGACTGTTG
CTAACCGGCGCCCAGTGACGCTTTAAACTGCAAACACTAGAGAAGATGAACGAGTCCGCGTCCAAGGTGAGTCTCGCTGCAAGTGAGAAGCCTTCCACAG
CTAGCAGCTCAAGCTCGCCAAATGGACGTAAGACGCGGACAATCATCGTTGCAAGAGCGATCAGTGACGAGCCTGCCAAGGTGACACCAGCCACCAGTGA
CGTCGTGAACCAAAATCATTCTCGTGATGCGCGATCTGGCAAATTGGCCTCTTATGCAGCACTCGGAGGCGCTGAAGACGTCGAGCGCTTTGATCAGTTC
TTGGCTGAGCAACGTGGCCAGCCAAGCGCCTCGGAACTGCGAGCAGCAGCGACGTCGCCATTGGCGTCGACGAAACGGAAGACTATGAGTCGTGTACAAC
TGGAAGGAATCGACATAAAAAGCGAAGAAATAGAGAACGACGCTCGTAAGCGTCGAGAACAAGCCGTGGCTCATCGCAAGTGGCTAAACTCGCTCCCTAT
TCACGAACGGATTTCTCAACAGCGTCAACAAAATGCACTACAAAAATGGCGGCAGATGAATCGAGATTGGGAGGCTTTTAAGATCCGAGCGGCACGGCGA
CTAGGTAAAGCTCCTCAAGAGCTTGTCATGAGTCGAGCGGCAGCATACCGAGAGCAGCGAGAGATGTACGACGCCCTGCAAAAGGCTCGACCATTAAATG
ATAAGGTAGGCGAGGATATCTGGCTCGTGAGTCTAAGGAATGAAGGTACGCGGTACGTTCCTGTAGGGAATATCTTCAGCGGACTATTTTGTCCAATCAG
AGAGAGCACAAAAATTGGTCCTCGAGTTCGACGTCCACTGGACTATTTTGACAACCAAGAGAACCGTGAACATGAAACCTCGCGACCATTATCTAAACTC
GAGAAACGATCTCTGAACCTACTGGCGCGCAAGAAATGGCGTCTACGCAAGCAACTTGAGGTGATCCAACCCCATGAAGTGGATCGTAGTGCCAGTAGCC
ATCTAGCAGTTGGAACAACCGACTTGTTCGCTTGGGCATCGGGTGAGACCAAAGAGTCGAAAGTAAACGATGATGAAGCATCTGGCTCATCATATCCTGA
AGAGGAAGCTTCACGTCGTAGATTACACTCGTATGCAAGCTCAAGTTCCAAATTTAAGACCGAGGCAGTGTCAGTCAGCCAATTTATTGGTCCCAGTCTA
CGAATTGCCTATGTTTCAGACGACGAAGAATCTCAATTAACACCTGAAAGCGGTGGAGTTGACGGTAGTAACTCAGAGACAAGTCTTCCTCTTCGTCTAA
GCCTTTATACTGCAGTAAATGAGCAAGATCAATGTTCACTATCGATCACGAACGATGGCAATACGATCGTTCACTATCAATGGTGGCGAGCACCTTTCGA
AGATGATAACGCAGAGATGACAACTCGATTACGTGGACATAGAACACGCAAAGATGAGCAAGAAATGGAACAGGTGATGACTATTTCTTTGTCGAAGCGT
GGGGGTACATTGTTACCGGGAGAAACTCAGCACTTTGTGTTCACCTTTAAGTCGTCGAAAGCTGGTATGTTTCTTGAAAAATGGTTCCTGGATGCAGACC
CTCGACCTCAAATTTGTTTTGGGTTATCCCCAGTCGAATCAGTGACTGAGTTACCGATTGAAGTACGGTTAAGTTGTGTTGCTGAGGACAATTTTTCAGC
TTGGAAGCGACGTGAGATGCAGCTCACTCGAGTGGAACAACGAGAGAGCCACTTCTTCGTGACTACTATTGTTGATGATATACTGGATTCAGTGAGACCG
GCGGAGCCTGTGGAGTTTACGGCGTTGATGCCGCGTGATGACGTTAAGAGATTCTACGAACAGAATGGTTCTAAAGCGTTTAGTGACGTCTACTTTAGTC
CAGAGTTAATAAGCGGCTGTCACGCACTGTATGAACGTGCTCAAGGGATTCTAAGAGCTCTTACACCTGCAACGCCAATCGAGGAGGACAATACTAACAA
GGACAATGCTGATAATGCTGAAGGTGTTGAGAATGCCAACACTGCGTCAGAGCAAAATGGCAATACGGATCGTGCTATAGATGAGAAACAGACCGCACAA
GACACCCCGCTTTCAATTCAGGAGTGGAATTGGCGGTTAGAAACACTTGGTGAGCTCTGTAAGATGGCCGATGAAGCTCAAAATATACAGATACACCGCT
TAACTCAGCAGTTGAAAAATGAGATTGAGAACGTTGAGGAGGACGACAACGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGAATGATGAAGATGAAAGTGA
AAGTGATAGTGAAAACGGTGAAGCTACTGAGGAGAAACCTCCACGTTTACGTCCTAGTGAAGTGCGTAGGATGGAGAGATTGGCTTGTCGTAAGGCTCTT
GAAGACGAGATCAGTACTTTGAAACCTGATCTAATGGATACATTCGACATGCTGCGGTTTGTAGCCCACACAGCGCCTTACAACAGTACTCGACTGCAAG
AACGACTACACGAACGAATCGGGAGTTTATGTGGTGAATTACCGATAGTCTGTGAAATTGCTCAGGGTTTGAACATGGGAAGTAATTTACCCGCGGTAAA
GTTAGAGCGAGTGGGAAAATTAATCGTTCGCGCTATTGACGAGGCCATTGGAGGTGACCAGGAGCACCAGGCTTTGTTTGAGCGGGAACGACGACGACTC
CAGAGCATGTGGCTAAGTGACAAGGCGTCGTATTTGTCGGTCAGTCAATGGGCCGACAAGGCAGCTTTGAGCGCAGATAGTTTACCAGTACAGAATCCGG
AACATTTCGATTGTTCTGGTGTGTTATTGATGCAGGTGGACTTGGATCTGGCCTCGTGGTTCTCTCTGGTAAAAGCAGACAAAGAAGCCGCAGCAGATGG
AGCTCCAAAGATCGAGTTGGCATGGCGTTTTTCGGAAGAGTTGGTCCAGCATTCGTCTTTTGTTCCTGCTAAAGTGATGGAGGCTACAGAGTCGTTAGAA
AAGGTGTTGAATGTTCTGTCAAGTGCAATCCCGAGTGTCCATACCCTCATACTTGTAAGCGAGTTAAGCCGTCCACCTCTGACAAAACAGATGAATAGAT
TACTTCGCACTGCAGCTCAAGCTGAGCTAAAGGCTAAGGCACTTGCATCGGATCAAACAACAGAGACTACGGACAGCAAGATTCAAGAGAGTGAGGAAGC
AGAAGCGACGAGTATGAAGGGTATTCTAGAGATCTTATCTTCGCAGCTCTCGCTTCGTAGTGTCGCTCAAGTGATGCAGCGTGCACTCCACAAAGATGTC
GTGTTTTGCTCTGCTATCGAGGGCGTACAGGCTCAGATCGACTTGAGTCGCAAAGAAAATATGCTGAATACTATTAGCAATACTGTAGACCCAAAGAATG
TCGAAATGTCCCCGAGAATCGTGCTGCTTGAGCACCTTGATGCCGCTGGTATAGACCTCATCACTCAAGCTTCTCGGAAGCGTGAGATGGCGGCTTCAAA
GCCAGCAACCCCAGCTCCTGAAGCCCAGAAACCTGCGAAGAAAGCCTCAGTTACTGTTGCTAAAGGAAAGCCTGCAACACCTGCTCCTGTGCCGACCCCT
CCACCAAATACTCTGCCAGTTCATGATCTTACGCTCGAGCTATCCGGAAAAGAATTGAGTGAGAAGGGAGTCAAAGCACTACGAGATCAGTTCGTACGCA
TGGCTAGTGCCTGCGTAATGGATGGAGTTCCATCGCAAGAATGTGAGGGTGTCTTCCTGCCAGACGCCAGCGCATCTTTTCCAATGATTGCGGGACCTAA
ACTATCCAAAGAACTCGAAATATGGTCCCAAATGCTGCAACCAAGTATTACCCAGCCTAGTGTGCATACTGCTGTGGTTGGTGGTAAGTGCCTGGAGTCT
AAGTTACGACTGATTGATGGCCTATTAGAGCTTGTCCAAGAGATCTACTTTGTCGGCGAAGTGGCTATGAGTTTGTATAGAGTTCTACATACGAAAGCAA
GCAAGTCTGCTACATTTAACCGTGATGAAATGAAGGTAGAAGAGGATGAAGAGCTGGAAGAAGACGCAGAAGTCTCCAAGGAAGAGACTCTAGAAGCCGA
ACCTACTACTGAGAAGGAACTGAGTGATCATTCCAAGGGATTGTGGGATCTTCTTGTACCTGCAGTGGAGAAACTTCAACAGAAAGCAAGTCGTAAGTGC
GTTCGCCTTCTGCTTCCTATCGATTGGATTGTAGGCGAGACTCCGCTTGAAGAGCAGGATCTCACTGCTATTATCGAGGAAAGCGACGAAGAAGAAGAGG
AAGAAGAGGAGGAGGAAGAAGAGACTAGTCGCAAGCGGAAGAAATCGCAAATGAAGAGTGCTAGACAAAAGCCACTAGTGGAGCCTGACCACGCCGATGT
GTTCGAGCTCAAACGCCACTATACGTACGAAGGCGAGCGAGCGCATGTTGTTCTTAACCATGCAAAGCTCAAATCTGATGCGGGATGGCGAGCGTTTGAA
GACGTAACAGTGCAGTGTTTGTCTAACGCTCAAGTTATGGAGGGAAAAGCGAGCGTATTGGTGTCATTCTACGCTGATTCGGATGAAGAAGGTGACGACG
ACGCAATGCACAAACCTCCAGCAAAGTTTCAATATGATTGGACTTTCCGTGCGTTGGATGTTGGACCAATCGCAATGGAGGCGCTTGCGAAGATACTGAA
GCAAGAAGAAAGAGAAGAACCAGCTTCCGATGCCTCTATGCAATCGAAAACGCTCATAGTTAGTGGCGTTTGCGGTGCAGTTGAGTTCCAGGAGTTCTGT
GCGGCTACGAAGAAGTTACTGAGGATTCTTCAGGACCATAACCTACAGCAAGTGTTCATTGCTGGGAGCTCAACAACAAGCTGGCTTCGACAACTGGAGT
TCGAGCAGGCTAATGAGCAAGCCAGGAGTAGCGATACAACCACCTTGCAGGCCAATTCAAACACCAACGTCGATTCTAGTGCGCCAACCCGTGCCCACAA
AGTGGTAGACGATCGAGCGATGCGTAATGCTCGCGTGCTCAAGCAACTCATCGCTGCCAAGCCACATCTGATTCTTGCAAATTTGGTGTCCTCCGACTCG
ATATAGTTTGGAAAAATATGCCAATACACTGTACCTTGGTCCGTGTTTCTAACTATTTTCGGACAGTAAAGATCCAAACTACACTACGTAGTAGCATGTC
ACAAGTGGAAGATCCAATAAATGACGGCAATGTTACTGGACTCAAGGGAGTCACTTGTCAAGTTGAAGTGACCGCTGCACGACTGCAAGTCAACTTTCGA
CTATCCACGAGTCATTGTCGAGCGTGAAATCGGTCGCAACGAGCTACACGTACCTCGCATCGCAAAAGGCATATATCTTTCACGTACTCATAACGTATGC
CGCAGATGTGCCTTCGCTTCGGTTTAACAAGCGTTCCGCATGTTGGTGATGAATCAACACTAGGCACCACGGTTAAAGGTTCGTATGTAGTTCTGTATGT
AGTTTCGTACACGCATGTGCACGTCGGGGCACCACCGTAAGATGATCCATTCGGCCACTGGATGTATCTTGTGCCTCAACCTCAACATTTATTTGGGTTG
TCATCATTTTCGTTACTAATCGGATACGACCAGGCGCTAGTAGTGTTGGGTAAGAGGAGAGGATTTCTTTATGTTTTTAGTATTTGCCACGACAATTTGC
CAAGTGGACACGCATGTGCTGTCTCACTAAGATGTCGATTAAAGTAGTCACGTGTCGAAGCACATGCCTAAGATCATACGAACTACTTCATCGTTGCGTT
GTCACTCGAGTGTCCCTAGAAGTGATTGAACATAAGGTCAACTAGATTTAATACGAGAGGCAATCTTGCTGCTGCGGTGCTTCATTGCAACCTCATTCCC
CAATTTTCACTCGTTCACTCGAGTCCCCCCATCTCACTTCCACCTACCACGGTGTAGTGTTCGCCCTCTTCAGGTAAACTTCTTGGTGAATACCCTCTAC
AACAAGAATGCTGTCGTGCAAGACGTTCCTCAAACTGTTTGCGGTGGCCGTCGCGCTCTCCGATTTCACCGCTCATGCCGACAGTACGCATGTGGCTGAC
TGTGAAATGATCTACGATGTGGTCACGCCGGCCCCAACCGTCCCAGTCACTCCGTGCCCCAAACCTGAGGGTCAAGACTTTATTCCGACTGATGTTGAAG
GCCAGTCAACTATGCAGCAAGACAACTCCGTCACTACTGGCACTACACCGAGTAATGGATACAACTCGAGTTCCGATGGTAGTTTGGTTAGTGTTGGCGA
TGTCTCTGACGCGTCCGGCGAACGTCCTAGCACTGAAAACGGTGACATTCCCGCTCCAAATGGAGTTGACAGCACCAACAGCGTACCCAGTGATACAGGC
GTTGTCGATGCACCACAAGACGACCAAAATGGCTACCTCCACAGTGGCGGAGAGACAGAAAACAATGCTAGTACGTCCACCGGCAAGGCCGATGGAGCAG
ACGTCGGTGTAAACGTCGATGCAACCGTCGATTCTAACCCGAATTCTGGTTCGAACATCGACGCTAATGTCGGAGCATACGTCGGCACCAACGTCGGTGC
TAACGTCGATGCCGGTGTAGATGCGAATGCCGACGCTAGTGCCGGAGCAAACATCAGTGCAAACGTGGATACCGGCGTGAACGCCGATGTGAACGCCGAT
GTTGGTGTCGGTGCAAACGTGGGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAAACGTCGGCCTCGGCGCAAATGTC
GGCCTTGGTGCTAACACTGGCCGTGGCGCTAACGTTGGCGTTGGTGCAAACGTCGGCCTCGGCGCATATGTCGGGCGTGGTGCTAACACTGGCCATGGCG
GTAACGTTCGCCGTGGAGCTAACGTCGGCGTTGGTGCTAACGTCGATGCCGACGCTGGACTCTCGGCTGGGGCCAGAGTTGATGCTGATGCCAACCTATC
GGCTGGTGTCGCTACCACTCGCCGTCTGCGGAGCAACTACTAAATATCTGCTGCTTGCCTAGAAAGTAGCATTTCCTCGTGTAGATACATTTTCTGCTTT
TCAAAATTTTTAAATCAATAGATTACCGTTCATTCATCATACTTACAGTTAGTAGTCGGTAATTTATTGCAGTAAAAATGCTCCTCAAGCGTATTTGGAG
TATCAGCCAATGATCAACAACTCTCTTGGCGCCGAATCCAAAATTCAATTTCAAAATGGAGGAGTACGACCGGGAGGCTCCGCTCTTCGACCGGCGCTTT
CACGTGCTGGTGCAGTACCCGGACCGTGACGAGAAGCTGCTACCGCTCACTACCCGCCTGCTCACGGGCGTGCGCGTACGTGCCGCCTACTCTCTCTTCC
ACAAGTACCCGAC