Description :
From Genome Similarity Track
Location :
Scaffold_383:5472- 8436
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.8Flagellar associated protein

Sequence
2964 bases(100 bases per row)
ACTTCTTGTCCTACATGACGCCGTCTCCATGTGGCGCGTCGTCCTCCTCGTAGTCGTCAAAGCCGAGAATCTTGTCGGCGAAGCTGAGCGCCGAGTACTG
GCGGTCCAAGAGCTCGGCGCCGCTCGCGCCGCCGTCGGCGCTGACCACGAGCGCCTTGAGGCAGCTCTGGAGCTCGTCCTCGCTCATCTGCTCGCCCGAG
TGCAGCAGCCGTGCCTCGAGCAGCTCCCACGGCAGCACCGGCGCCGAGTCTTCCGTGGTGTTGGCCTTCCCTCGCTGCTGTCGCCGCGCGAGCACCTCGA
AGGCGCGCTCGATCTGTGCCTTGCCGACGCCGAACACGGGCCGGTGGTTCACGTACAGCTTGAGGAACTCGGCGAGGTCGAGGCTCTCGACGGCCTGCGT
CGTCTCGGTGAACTTGGAGAACTTGACCTCGCTGCACATGTGCTGAATCTCCTGGTCGGTCGGGTAGAAGCCGATGGCGCGCATGACGTTCGGGATCTCG
CGCAGCGGGATGCGGCCCGAGATGTCGCGCGCCGCCGTCGCGTCCTCGCCCTGCACGCGGAGCTGCGCGAGGTAGAAGTAGTCGACGATCTCGTGGTAGA
AGGCGCCGTCCGGGCCGCCCTCGAGCAGCGACAGGAACGGCGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCACCTCGGTATTGATTGTCGTC
GGCGGCGCCATCGCCATCGCCCCCGCCGCCTCGAGCGCGTCGAGCTGGGCCGTGTGGATCTCCCACATGTTGACCACGAGGTCGTCGACGCCCGCGGTGA
GCAGGAAGCTGCCGTCGCTCGTGACGTCGACGTTGCTGATGGCTCCCGGGTGCGCGATGAGCCCCATGGCCTTGTGCGGGTTGCCGTCCAGCGGCAGCTT
GAGCAGCCCGACGACCTTGTCGTGCGTGCTGTACGCGCAGTAGCGCTCGCCGACCGTGGCTGCGCCGTCCAGCTCGCCACCACCACCACCGACACCAGCG
CCGGGCTTGAGCGGCACGGGCACGAGCTTGTTGATCGGGCCGCCGTAGCACGGGCCGAGCGTCGTCTTGCGGCACGTCGTGTTGCTCGCGTTCCACTGCT
TGAGCTTGTACTCGTCGTTGGCCACGACCACGAGGTCCTCCTGCAGCCCGCGCATGTCCGGGTGCCAGCAGCACGCGGTGGGTACGCCGCTCTGCTCGAT
CCGCGTCGGCGCCTGCTTGAGCACGACGCCGTCCAGCACACTGCATCGATCGAGCGCGTACTCGACGAGCGTGCGGTCCTCGGCGACCGAGACGAGCGCG
AGGTTGCCGTCGCCGTCGCGCGAGAACTCGAGCCCCGTGACGGGCTTGCTGTGCGCGCGGCAGCGGCCGATGAAGACCCACTCGCCGCCCGTGCCGTCGT
CGCTGGCGTCGAACTTGCAGCGCCACATGCCGAGGTACAGCGTGGCGTCGAGCGCGACGAAGAGCGAGGCGTCCGGGCTCACGCGCACGTCCGTGATGGC
GGCCTTGCCGAGCCGGAAGGTGGCCAGGTCGTCGAGCCGCTGCGCGTGCAGGATCTTGATGGCGCCGCTCGTGAAGCCGACGAACAAGCGGCGGCCGTCG
GGCGAGAAGGCGAGGCACTGCGGGCGGAACTTGTCAGCGTCGAACTTGCGCATCATGATGAGCCGCTTGCCCACGTAGTCCCAGAGCTGCAGCACGCCCG
AGTACGAACTGAGCGCGAGCTGCGGGTGCAGCGGGTGGGCCGCGAGGCCGTGGATGGCGTCGTTGATGCCCTGCATGAGCAGCGTGCCGCGCCGCTTCTC
CGGCTCGTACTCGCCGAAGAGCGACGCCGTCATGCCGACGATGAAGGCCGAGGACGTGGCCGCGATGAAGTCTGGCACCGTGAAGCGGTCCTCGTCGTCG
TTGCGGGTCGTAGGGCTTTCGTCCTCGTCCGCGCAGGCGAACGAGACGCTCGTGACGGCGCCGGCGNNNNNNNNNNNNNNNNNNNNCATGTCCTCGAACC
AAGCGACGAGCCGGAAGTCAAAGTCGAAGAACCGCACGGCGCCGTCGCTCGAGCCGAGCACGAGGTAGCCGTCCATGTCGGCGAGCACCGTGAGCGCCGC
GGGCTTCTTGTGCTCCGAGGACCCGCCGAGCCGCACAATCTTGACGGCCTTGCGGTCCGGGAAGAGCCCGCTCGTCGGTTCACTGGCGTTGGCATTGCCA
GTGGCGTCGGCGTCGGCGGGGACGACGTCCCAGAGCACGAGGTCGCCGTCCTCGGTGCCCGTGAGCGCCTGCGTCGAGTCCGGCACGAAGAGCGACTGCG
TGAAGTTGCCCACGACCTGGCGGAAGTCTCGCTGCGAGAGCGAGGGCGAGTAGAAGAGCAGCTTGTGGCTCGCCCAGTTCCAGAAGATGACGCGCTGCCG
GCCGTTCGAGACCACCTCGCGTACGTCGTACGTGTTGAACCGCACGGCGTGCTGCACGTCCTCGGTCGCGACCAGCGACGAGTGAAGCGCGCGGTTGCTC
TGCGCGGCCGGCGCCGTCCACTCCCACACCGACAGCTCCTGGTCGAACCGCTTGCGCTTGCTGGCCTTGGCGCCATTGTTCGCCAGCGTTGGCTCGCGGG
CCACGGCGCTGAGCGTGACGATGAAGAGCGCGTCGGGCGAGATGTCGAGCGCCTCGACGCCGAGCGGGTGCGGCTGGAAGATGGTCTTGATCGGGTGGCC
CGTGGCCGAGTCCCAGACCACGAGCATGGCCTCGGCGCCGCGGTCCGCCGTGACGATCCAGCGCTTGTCCTCGCTCACGGCGCAGCAGCTGATCGGGTGG
CAGTGGCCCTGCAGCAGCCGCTGCTGGCGGCGCGCGAAGTCGTAGATGACGCCCGTGTGCGCCGCCGGGTAGAAGACCGCGCGCCGCGCAGGCGTCGACA
GGTTGTGCACGCCGTTCACCAGGTCCTTCTGGAACCCGAACGACCACGCCAGCCGCAGCGCATT