Description :
From Genome Similarity Track
Location :
Scaffold_1:5470565- 5483544
Transcript NameFunction/comments
Physo_478274Hypothetical protein
Physo_474078Hypothetical protein
Physo_474250LysR family transcriptional regulator
Physo_323470Hypothetical protein
Physo_470548myosin-like protein
Physo_556055myosin-like protein

Sequence
12979 bases(100 bases per row)
GTGAGTATGGCAACCTGCTCGCGGCGTCCAGCGACGCAGTTGGCTCGCGTGGCCGATCGATCGCCGCTGCTAGTGACTCTCCAGACTAGCACGAGCGTAG
TCAACGAGGCACCTCCAAGTCTGTGCGTCGTGAAAATCCGCTCGACGCTTTTGCATTTCGTGGCGGACGGATATCTGCGGGTGAGTGGGAGCAATTGGAT
GCATCCACATTGTCAATATCTAACCAATTCAACCATCGTATCCCTACAGTGTGTGATCAGGTCCAAAGTGCCGATCACCGACGTCGCAGACTACGGCATC
GACTGTAGCAGCAGCAGCAATAGTGGTGATGAAGAGCGTCACAAGATTCTGGTCTCCGCCGCAGATGGGAACGTGTGGGAGGTGACGTTACCGGCCAAGT
TACAGCCTGGTGTAAGCGTACTGACTGGTGACCTGCTGCTGGAACGGTCCAGTAGTGAGTGTGGTGGGGGAATGGTGCAGTGGTTCTGCCAGCTCCCGGG
GGTGCAGTCGATCGAGCATGCATCGGCGGGCTCGGGCCTGACGTCACTTACGCTGATACGGAGTCTAGTGACACCGTCCACGTTGATCGTGAGCACGCGT
GGCAGCCCGGGGTCAAAGTTGCAGCGTCACCAGTCGCTAGAATTGGATGAGATTGAAGGCGAGCAATCCACGTGCACACTTTGCTTGAATAGCCAGGACT
CGAGGCATGGTGCCTTGATAGCGAGCTTGTTTCCAGACGTCGCGAAATATGCAGGTGCAGCGGCTATTTTGCAGGGAGATCTGGATGGTTGGGTGCGGTT
TTCGTTGATTCGGTACCGTAGTGGGAAAGGAGATGTCGCCAAGGCGTCTGTAATTCGCAGTGGAGCTCTCGTTCGGCTGGATCAACCTGTGCAGATGATT
GCGGCCTTCACGGCGTCTGCTCTACGTGCATCACTGACGGGGGACAGCAACAGCAATGTCTTGTCAGCGTCCAATGCGCTGCTCGTGCTCGGTACTCGTG
GACAAGTTGGAATTGTCGACCTTAGAAACGGCCGGGGCATTGAAAATCTTCCTGTACCACTGACGCAGGTAGACATTGGGCATCCTGTGCAATCGCTGGT
GTTTGTGAACAATCTAGAAGTGTGTGTGTATTGCTCAAGTGGGTCTGCATTCGTGTGTCGAACTGCTGATCTACTACTAGATAAGCACCGTGCAGTTCAA
AAGGCGACCGTAGAGCTAAACGATAACCTCCGTGCGTTCGCCGAAAAGTTGTCACTTCCACCGGTACGCGAATCACAATTTACCGTATCCGACATGATCA
AACTAACACGTGTGAATCTGCTCAGGGGGTGTTGCGATTGGAGACTCATGACAATGGGCAGGGCATATCAGTTCTCTTTTCATCGGGAAGGATCATTAGT
GTTGACGAAGTAGAGCTACGAGCGATGGTATCAGCTGTACTTCCAGAGACGTCAGGAATTCAAGGACCAGCATCTAGAGCCGAGCTGGCGAGCGAGTCTC
GAGTTCGCAATATATTGCATCGCATTGCGCAGGTGTCCACAGAATCAAGTACCTTGCGTGCGCAATCGAAGGAAACGGATCACCACTTGAAGGCCCAACA
CTCGGCCTTGGAAATGCTACGGCTCGCGAGAACGACAGGTTAGTACGAGCTATGTTTCATCACTGGTGCGTGTTATTTCACCATAGATACACTAATTGCT
CGTTTGCTATTAGCAGGCGTGGAGGCAGTCGTGAAGTGCGAGTTGGATGCTGCCATTGTTACAACAGGAAACTTCTCGACTCGACAAACAGTGAAACTGA
TGTTCTCATTGCGGTTTGTGAACCCGGAAGCTTTCGTCTCGTCAGATCAATGGTGGGTGATGCTGTGATCAGTCGTTAATTCGTTGCGTGTAGGAGCGTT
CATTTCGTATTTTGACACTGCTCTATATCGTTCTTCGTGTAACTGTACAGGTGTCTGTGTCTGTACGTGCGCACGCGCAAATGTTCAGTAACTTCATACT
CGTTTCCGGTTGAAGATATACTCGCTGGAAGAAAAAGTATTATCCTCAACCCTGACATGTTTGCTCTACAAGACCGAGGGGCTCTGTGGGTATCGTGCTC
GCTGGTATTTTGTCCGTCCGAACATGTGGAGACCAAGAACAGCGGAGCGAACAATATTGACTCCACCGAACAAGAGGGCCTGATCTCATTTGCCATCCCG
CTCATTCATGACCGAAGGTTCATGATCGCACAGCTAAGCCAGCCTGTTGAAGAAGAAATCCCGGTCAGCCAAGTCGCCATTCAAGCTGCTTTTCGCCAAA
GTCATGACCCGGTACTACTACCACTTGGTAGAGCAGGCCACAGAGACAAAGAAGTAAAGGCCTCGTCCTCTGCACTTTGGAGTGGCGTGCAATGGTGGGC
TGTACTTGCTGATCACGCTCACAACAATCCGTCGTTCGCCGCAATGTGGTCGAAAGTGGCGCCCCCAACCTTATCACTATCGCCCCCTTCGCGATTTGTG
ATATCTATCCCTTCATTCTTTGTCAGTGAAGATGATGAGGATGACGACGATGATGAAGATGAAGACTTTGAAAAGGTTCGCGTTGAGAGAATGATATCAT
TTTTGCGGCAACTTTTGGAGATACCCATTGAGGAGGTCCCCCGGCTGCGTCGTAGCTGCCGAACTCAACATGGCAAGTTGTGGACAGTGTTGCGAGCGTT
GTCGGGAAGCCTCATACTATTGCGTTTCACCCCATCGGAGGACGAACAACGATCAGTTGACCTCACTATCCAATGTTCCGACTTGGCCGACCTCTCAGCA
GTATGTATCCCTGGCTAGTAGCTAGCCATGCTTAAATCTAACGGTCTCTGCTACATGGTGTCATGCAGATGCGAGCTCTTGTGCTTGAGGCTATCAACAA
CTGGAGCGATGGCGTCGCTCGGGGAAATAACGTTGCCGACTGTTCTGAAGAACTAGCTCTGGATATGAGCGAGCTGCTGGAGCCTATAGCATCGCTTGAA
AGCATCCTGGAGGTTGGTAGCTCGATGTCTATCTGAAATTCCCCGGGTGTGTCTGTTTTAACGTTGTACTTGCACTGGCTGGACAGAATCTTAAGGTGAA
GATAGCGACAAGAATCGATGACCCTGCGTCGGCTATTTGTACCGACGAAGTGCTTCGTGCGCTGTCACAACTAGCGCATGTAGAGACGCAAACGCTCACG
CTGTACTGGAAGACAAGGTTGCATTTGAACAGGACGATCATGTAGTGATGTCGGTATGGTAGCGCTGCTATAGAACTGTAGGACGATAAGTTTATGAGCT
AAATTGAATCATACGCGAAGAGTTACTACGAATCGTGCACAAAGCTGTAACAAGCTAGCTACAGCTCTTCAGTGGGAAGACCTTGGTCGCACAAGGATGC
TTTCTCAGAAGGAGAAGATACGGAGTAGAGGCGCTGCACGTTGGATACAAGCCATTTCGCAAGAAGCTTGTTAGCTGGTCGAGCCGCGACAATGAACAAA
AACATTTTATCGTGATGATCCCATACCTCGAAGTAGCGAGGCGCCCGGCTCGGCCAGAGCGTGTAGATGAGGGTCAGATAAATGAAGCAGTGCACCGACG
TCGTCATGGCGGCCACTGTCTTCTCGCGCACCCACGGTGACAAGAATGACGCGATGAGCACAATGATAGGCAGAGCTAAGAAGAATACTGAGAACAAGCA
GCACATCTGGAAAAAGAGTATTGAGTCACCAAAACAACCAACCATATCAATGAAGGAACTTACCCGCAAGAAGAAGTACCGCTTAGCTGAAGCCTTCTCG
TAAGAGCGCGTTTCCAAAATGGTGTTGATGAACCACCCGAGTACTCCCATTTGCAGCATGCAGATCCCAAGCCCCGGCCACGAGTCGTAAATGTAGAGCG
TGGATGCCGGGTCGAGCCATACCAGGTACCACATGGCCATGGACAGATACAGCACGAGCACTGCCAAAATGACGCACGACAGCTTGATCTGACCGTCTAG
CGCCACACTGTTGATGGTCCATCCTTTGGCGATCAACATGGAGAGTAACAACGTCCCTACCCGAACGAACACTTCTGTGATCTTTGCCGCATATTTGCAG
AACGGCACGCCCACTCCGTTGAACTGATACACGGTAAAGTGGACGAAAAGCAGCGCGTTGCACAGGAAGAAGAAGAACACCACGAGTGTGAGGATCCTCA
TAATGGGGTGGAACGATTCGCTGCTTCTCATCCCGCGCACTGCCACAATTTGCGCCGCAGCTGCAGCCCCCGCAACCGCCGTCATGACAGCGTAGATCGT
CGGCATCCCTTGCTGCTGCACGGGGAGCTCGCCTCCATCTCCTTGCGTCATGTGGATGTTGTACCACGACGAGAAGTAGTATTTGCGGAAATTGGTCTCG
GTTATCTCGGCGAAAGAAGGCTTGTACTCGTCCCCGCCTGGCACGCAGCGTGCCAACGCCACGTACCAGAATCTCGGTCGGAGGTGCTCGTGGATGTCCA
CACTGAAGGAGAAGGGGGTCACGTGGTGACTCGTAGTGGCGGTGACATTGAACACGCTCTTGGTGTGTTTAGAGGATACTTTGCAGTAGCAGTCGCACGA
GCTCTCGGTCATGATGAAATCCCAGAAAAGCGCTTCATCGTCGTAGATGGCAACTTGCAGGCCGTTCACGTCCGTCTCGATCTCGCCTGCGATACGCTGG
CAATAAGAAATAGCATGTTTTGCGGTTAAGGTAGTGCTAACTGAGAGGAGTGTGTGTTGCTGTTTACGCACCCCAGCGACGTCGTCCAGCGTGGGCGTCC
AGGAGAAGCAGAACTTGCCGATGTACTGGAACTGCCTCCCCACAGTGTAGCCCGCGTAGATGCTGCCGCGGACGACGGAAAGCCACGCCGCGAGGCAGAG
CAACAGCGAGAGCGAGCGCATGGTGCCTGGCTCCTTTTTGGTGGTGAATTTCGATGAGCGATGAGAACCAAGCGACGACTGGAGATCTTCTAACTTCAAG
AATGCCGCGATTGGCTGGAAATGTGCTTCAGACAAATGTAGCCAAGTCTGCTTGGAAATGGCTACACTATTGCGGGGTTCTTGAAGGCGAAGTGAATCTT
AGGCAAGGGCGTCGACGAATGGTCCGCCTGGGGCTAGTTTCTCACGTTCACTACTGTGCTTGGTGCGGCCTGGAGGTCTCGGTGTCAGACGAGTGGAGGA
GCGCAACCCTCTCTCTGCGGCGCATTTCGCCGGCGCCACGTTCACGTGAGTCAAGAAGCTAGCCGATTTCTGGCTGGAGGTGTCGATCGCCAGCGGATAT
TTTCTAGGCTCAGGAGCCGTCGGTACAGCAGCCGCAAACTGGCCGTGAGTTGGCTCAGAGTGGCTAGCTGCGGCTGTTGCTGTTGAGTGTTGGTTAAGTC
CCGAGTTGAGTCAAGTTACTGTTTACAGAGCAGAGGTTTCCGCCGCTGGCGAAGGCGTCAACGCAGCTGGCGGCGATGGCGGCGGCAACACTGCGAGTGT
CCTCACAGCAGCGGCAGCAACGCCCCGCTCGGTAACGGATACCCAGCGAGCTGCGGTTTTCGCAGCGATTGGAAATTGAAGAGGAATGGCTGGGCCGACC
AGCCATGGCGTGGTGCCAAGTTACAGATGTGAGCTTCGGCTTCACGCTGGGGCTCCAGCACATCCCATGCAACGGCTGCTGTCTTGGGGGCACCCAGTCG
AAGCCTGCGCTTCCCTGCATCTGGCTCCAGGTCGCTGCGAGGTTGTACACTGTAGGTACCTAGCAACTCGGCGTGTTAGTTCGCCCCGCTGCCTCGTTGC
CGCCGCGTTTGCCGCCTTGGTCACCGGTCCGCCGCCATGCCATGTCACGCGCGGCGCGATTCATTCGTGTTGTTGCGGCGTCGTCGGTCTCAGGTCGTCT
TTTCCACCAGCTGGGCGCCGCTCTTGCTTTTTGTAAGAGCAGGGGTAAGGGCAACTTGACCATCGGTTAGGGAGTCAGTTTTTCAACGGTCCAGCGTTAG
CGTTCGAGCGGGCAAGTCCTGCAGGGCATTGGCAGCGTCCGGTCGTGTGCGCGGAGAAGCAGTGCGGAAAATCTCCCGTTTGTTTCGTCGCGTGAAGGAG
GGGGCCCCGGCCGTGTGTGTGGCATTGCCGAGAAGCCGCCCTACAGCTCAGCTCACTCGCGATCGATCCAGCGTGTCCACTACGCAGGACAAGGAAGTGA
GATCATTTGTCGAGGCTAGTCATCCCTCCTCCTCTTCGTCTTATCCAGCAGCGTTTAGCACCACCACCTGCGGTCCAGCCAGCGACGATCGACCGACTGA
CTGACTGACTGACTGACTGACAGACGCATCTCCTGGGTTGAAAGCCACCTAACCGGACGGGTTGGTCCTCCCTCTTCCAGCAAGCATGACGGTGCGCCGC
ACGGAGGAGTTGCAGGAGTGGATCTGCAGCGTCACGGCCACGGCCAACGACCATGGCGAGCACCTCTCGGTCATGCTGCGCGACGGCCAGTTGCTGTGTC
TGCTGGCCAACGGCGTGGACCCGGCGGCGAGTCTCAAGGTCAACAAGCTCAACACGGTCTTCCACTCCAAGGCCAACATCCGCCTCTTCCTCGAGTGGTG
CAAGAAGCAGGGCCTGAACGAGGGCGAGATCTTCCAGCCGGACGACCTGCTCGACGCGGGCGCGGACTTCGGCGCCGTGCTCGAGACGCTCTCGATTCTC
TTCGACAGGTTCGGCACCATCGGCTACACGGGCGAGTACGAGGAGGACCCCGTGTCTGACGCCGAGTCGCTCACGTCCACGGGCAGCTCGCAGGGCGCGT
CCCCCGTCAAGAAGACCAACAGCAACAACAAGCTCTCCAACTTCATGAAGGGCGGCTTCCTGTCCCGCAAGAAGAAGCAGTCCAGCAAGAAGCTGGCTGC
GGAAAAGTCCCCCGAGGGCACACCGCCTTCCACGCCGCCGCCCGTGTCCCCGCAGGTGGGCGGCAGCTTCGTGTCTCCCCCGGGATCGCCGCCCATGTCG
CCACGTCAGCCGCCCCCGCAGAGAAGCGACAGCGGCGGCGCCAGTGCCAACCGCCTCAACGCCTTCCTGAGTCAGGTGCCGGCGTCGCACCAGTCTCCGT
TGACGCACGTAGAGCGTCCGTCAGGTCCGCCCAAGAAGAACTCGGTGCGCAAGCCGCCCCCGCCCAAGGCCAAGCCCGCGCCGACCGTGAGGAGGCCGCC
GTCGCCCAAACAGCCGCCCAAGTCGCAGCCGACTAGCGGCGGCAACGCGCGCAACAAGTTCGCGGCCTTCATGAAGTCCAATCCGCCTGCTGTCGAGACA
ACACATGCTCCGGCCAGCGCCTCTGGGGGTTCTAACCTCTCTGCCTTCAAGGCATCGGTCTCTCCCACTTCGGGTAATAAGCCGGTCGTGGCAGCGCCGT
CCCCGCCAAAGTCTGCGCCTACGCGAGCCCGCGGCACCAGCGAGCAGTTCGCGCAGCGCAAGGCCGTCTTCGCCCAGAGTGGAACTAGCAGCCCCAAGCC
GGCTCCTGTACCGCCGAAGCCGTCCGTTGACACGGGATCAGCTAACAAGCTCAACAGCTTCATGAAGCAGCAGCCATTTGTGTCGCCCGATGCGCCCAAG
CCTCGCTCACAGAGCAAGTTGGCCGCGTTCCTGGCGTCTACAAACTCAATCCCATCGATTGCAACGACACCCTCCGCTGCCCCAGCCAAACCGACGTTCG
CTTCATTTAACCCGTCCAAGAATGCTCCTGCCGGTGGTCGTTCGGCTCCGATGCCTGCTTACAGTGCGCCGACACCGGCAGCGTATTCGACGCCGAAGCC
TTTCAAGCCGCGTCACATGATCGAGCGCTCTACGGGCCGCGGCAACTACATTCGCAAGCGTCAAACGTACTGGGTGCCTCCCAAGCGTCGTCGCAACAAT
TTCAGTCTGGAGACCAAGCGGAAGGCATTCATGAACGAGCAATTAGAGATCAAGGAGGAGCAACTTCGACAACAGGCTGCCGGCGCTGGAAACAAGCAGA
ACCTGATTGTACCGGGCGTGCAGTGCTACATCCCCGACAAGGAGGAAGTGTGGTTGCTGTCCGAGATTGTGGATTTCAATGAGCGAAGAAAGGAAGTGAC
TCTCACGGTGTTCCTGGATTCTGGCGACTCGGAGCAGCGTGTGCTGAACCTGAAGGACCCTGAAGTCATTCGCGCGATTGGAGGTCCGACTGCGACCGAG
GTGGATTCTCTCCCTGTTGCCATTCTTCACGACAACCCGGAGGGTGTGGAGGACATGCGACTGCTTCGTTACTTGAACGAGCCGTCCATTCTGTTCAATC
TGAAGCAGCGTTTCGCCGCCTCAAAGCCCTACACGTACACTAATGATATCGTCATTGCTGTTAACCCGTACAAGTGGATTGAAAACCTTTACGGCGACCA
CCTGCACGAGCAGTACCTGCGGAAGCCGCGTGACTCGCTGTCGCCTCACGTTTACTCCACGTCGACGGCCGCCTACAAGCACATGACTACCAACGAGATG
AACCAAAGTATCTTGGTTAGTGGTGAGTCTGGTGCCGGTAAGACGGAGACGACGAAGATCGTGATGAACCACCTGGCTAGTGTGGCTGGTGGCCGCAAGG
ATAAGACGATTGCCAAGGTTATCGATGTAAACCCGCTTCTCGAGTCTTTCGGTAACGCCAAAACGACGCGCAATGACAACAGTTCGCGTTTCGGTAAGTT
CACGCAGCTTCAGTTTGATGGCCGCGGAAAGCTGATCGGTGCAAAATGCGAGACGTACCTGCTGGAAAAGTCGCGTGTGGTGTCGATTGCCGAGGGCGAG
CGCAACTACCACATTTTCTACCAGCTCCTGGCTGGTCTTCCCAGCAAGGAGCGCAAGGAATTCGGTCTGGACCCTGAGTGCCAGTACCAATACGCGGGTG
CGCTTGCGGACATGCAGATTCCGGGCTTGGATGACAGCAAGTGGTTTGAAGGCACTCAAAAGTCACTTACCATCATTGGTCTCGACTCAAGCGCGCAGAG
GACCCTGTTCAAGATCTTGTCTGGTGTGTTGCTACTTGGTGAAGTTATGTTTGACAAGAGTGGGGAGAATGGCTCGCGCATTTCGAGCGGGTCTGCTCTA
TCGCAAGTGGCGAAGATGTTTGGCCTTCCTACGACGAGAATCGAGGAAGCGTTGTGCAACCGCACAGTTATCACTCGCAACGATAGTGTGACGGTGCCGC
TCGCTCCTATTGAAGCGGCGGAGAACCGCGATGCGTTGGCCAAGACCATCTACTCGAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCTATCAG
CACGGATGAAAGTCGCATCAAGGGCCAGATTGGCGTGCTGGATATCTTCGGTTTTGAGGACTTCGTTCACAACGGCTTCGAGCAATTCTGCATCAACTAC
GCAAACGAAAAGCTGCAGCAGAAATTCACCACGGATGTGTTTAAGACTGTGGAGGACGAGTACATCCGTGAAGGCCTGCAGTGGGACCACATCCAGTACC
AGGACAACCAAGGTATCGTGGAGGTGATCGAGGGTAAGCTGGGTATCATCGCCCTGATGAATGACCACCTTCGTCAGCCCCGTGACACGGAAGAGGCTCT
GGTCAACAAGATCCGCACGAACCACCAGACGAAGAAGGATGGCAAGGTGAACGAGAGCATCGACTTCCCCAAGGTGAAGCGTACGCAGTTCATCATCAAC
CACTACGCTGGATCGGTCACATACGAGACGGTGGGCTTCATGGAGAAGCACCGCGATACTCTGCAGAAGGACCTGCTTGACTTGATCCAGTTAAGCAGTC
TGTCTCTGCTCCCGGAGCTGTTCGTGGACAGTGAAGTGGTGACCGAGGGTGGCAGTGGTCGCGGTAAGAAGGCCCCGAAAAGCCTGGGTTCTCAGTTCAA
GACGTCGCTGGCGCAGTTGATGGAGAACATCAGAACCACAAACACGCACTACGTGCGCTGCATCAAGCCGAACTCGAACAAGAGCCCGACGGAGTTCAAC
AAGCGTATGATTGTGGAGCAGTTGCGATCGGCAGGTGTGATCGAAGCCATTCGTATCACGCGCTCTGGGTACCCGAGTCGTCTCACTCCGAAGGAGCTAG
CCACGCGCTACGCTATCATGTTCCCGCCCTCGATGCACAGCAAGGACGTTCGCCGCACGTGCAGCGTCTTCATGTCGTCTATCGGTCGCAAGTCTCCGCT
TGAGTACCAGATGGGTAAGACGCTCATTTACTTCAAGAACGGTGTCATGGAGGAGCTGGAGGCCATGAAGTCCGACTTCATGTACTACGAGGCGCGAACC
ATCCAGCGCATTGCGCTCGGTTTCCTAGAGCGCCGCCGCCTGCGCAACAAGATCAATGCGGCCATCGTGCTGCAGTCTTACGCGCGCATGTCCTTGGACA
TGAAGGAGTATCACTTCCAGCGCCGCGCCATCATCAAGATTCAGCGCGGCTGGAGGAGGTACAAGGCCGTCCCCGTTGAGCCCGAGTACAACGACTCAGT
GGCGGAGTACAACAACAACGGCGGCCAGTGGGTCGACGACCTCGATGATCTCGACGACTCGGACGCTGACGAGGGCTTCGGTGACGACCCGGCATCGATT
CGTGCAGGTCGCGGCAGGTCGGTGGCGGACCGCATGGAGTCGTTCAAGGTCGCGCACTCGGGTCGTCGCGGCAGCGTGAAGCGTCTGAACGAGCTGTCAG
CTCGTGCCAAGAGCTTCATGAAGCCGCGAAGCCACAGCGGCAGCACCTCGAGCTCGAGCGGCATCTCGCTCGAGGACGAGAACTCGATGCTCAAGATTGA
GAACCGTAACCTGAAATATGACCTGGAGCTCATGCGCGAGCAATGCATCGAGCTGCAAGCCATCATCCTCGAGATCAACAAGAGTCGGAAGAGGTAAGAG
TCGTGGTATGTGTGGTGGTGTCGGGTGCAGCGCAAGCAAACCCCTCGCTGCAACTCCCAAGCTGGTCGGTCGCAGCAAGAGGACGAAACTTTTTTAAGTA
AACGCCCGGAAGGCGTATATGTGTAGCGAAAGCAAGAACGATTTTCTCTTTCAACATGTCAAGGCGTGAGTAGCTATTTGAACTGTTGCTCGTCATTGTG
CTTTGCGTCGCCCATCAGCATCGCCTTGGCGGATGACACTACGCTCGTCGGCGGTCTATCGGATCCCGTGGACTGAAGAATGCGGGAGAGGACAACTGGC
CTGTGCTCAGGGTGTGGGGTAGCCTGTCGTGTATGTCTCCACGTGAGTCACAGGATGGGGACTTGATCGAGTGGCTTCACCGCATCATCCCCATCGCGCG
CTTCGCCTTGTTATAGGGCGCGTTTTCCAAGCGAGAGTGCGCACGAGCCTACGGCGAGAGAACGGCATTGCCGATACGGCCGCCTGTATGGCACTGCTGA
TGCCCGACATCAACCTCCGCCGCGCGAAGCACCAACTTGAGGTTTGTTCTCGACGAATTCGCATGGATAAGCCCGGAGACTCATGCGGTTCTTGTCTGGC
GTGGCGTGTCCTGCCTGCATAGCGCTACTGGCGCCAACTTCTCGGTGCGGGTGAGCGGGATGGAGAGCGCAAGCGCTTGATATTCCGTTCCAAGTCGGCC
GCGGGGGCTAAATCGTCACAAACCACCAATCCTGCTGCTAAAAGAACCGATTCCGCCAAGGTCACCCCACCAATTCAGAATCTAGAGCGCGACCCGAAGA
CAGAGGCGGCCACTGCTGGCAACGACGAGATCGTCGGTGATTCTGATGCTGCCCAACTTGATTGCGGATCTTCTTCATTGGTGAAAAGCAACCAGGACAC
GGACGATGAGGAGGAGGACGATGAGGAGGAGGAACTGCACAGGATTCAAGCTGCCTCGGTCGAGTGCAACGAGTCAAGTGCTGAAAACGTTGAGGTCTCA
AACCCAGATTTGAAGTCGAAGACAGAGGAAGCGCCTTCCTCAACTGACACCGAAACGTCTTCGACTGTGAGCTCTGCAGTCACCACGCTTTCCTCGAGAA
GCACGACCGCTTGTGTGGGTAAGCCGCCTCTGTCCCGTGTTGGACCGCGCGTGGGCCACGACAATCGTTCAAGTTACTACATTATGCCGCAGCCCAACTA
CATTCCGCGAGTGAAAGGTAAAGTATCATTGAGCTTACTCTTGTTTATTGTGATCTCAGTTTGACTAACGGCCAATGTTCAGGTCCGACGCTGGGCTCCA
TCCTACAGCGGATTCATCTCAACGACGGCGACGTGAGCGAATTGGACTTCTCAACTCTCGCGCAGCGCAACAAGCGGCTGGAGTCTGAAGGGTGCGCGCT
GGTGGCTCGATCTCTTTCGACCAACCACACAGTTCGCAAGCTCATCATTCGCGACCACGCTATCGAAGACGACGGCGCTGTCGCTCTCTCCAAAATGCTG
TGCAATAACACGACGCTCGAGCATTTGGATCTCGTCGGCAACGCAATCGGTGATCGCGGGGCTGAAGCGCTAGCGCAGGCGCTTTACGGACACGATTCAC
TGACGCACTTGAGTCTGGCGAATAACCTGATCACCGACCGTGGCGCTGAGGCTCTCGCTCAGGCTATTCGCTGCAACTGCACCCTCAGGACTTTGGAGCT
GACGAACAACCGAATCACGCGAGTGGGGGCGCTGGCTCTGCTTGACGCCTTGGATGTCAACTTGTACGTGGAGACTATCAGCTTGGATGAGAACAATGTA
CCAGCTTTCGTCGAAAGCCAACTTGCTGCAGCGTTCGCACGCAACCGAGCCCAGGCGCTAATTCTTGAGTCGCATGCCGCGGAGAAGAAGGCTGTCAAGA
TCGTGCGCAGAGCCAGCGGATTTGATACCCAAGACGAAGACGACGACAGCAGCGAGGTGGACGAGGAGGAATGGGAAGGCTGGGAAGATGACGACGGTGA
CAGCGTGTCGAGTGGGTTTCTGAGCTGCTCGAACGTCACTGACATCCCGTTGAGCAGCAGCGGACTGTGGATTTAAGGG