Description :
From Genome Similarity Track
Location :
Scaffold_1124:547- 5840
Sequence
5293 bases(100 bases per row)
GGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGATAACGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCT
GACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACTTGGATCGAGCCCGGGGAGA
CCTGGGAACTTCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTCG
ATCACGATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTGTTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGG
CGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGC
TCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATTCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGA
GGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGATTAAAGCCGAACAGCCCCAT
CCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAA
ACTCGCTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCTGATACCAGGGTACCTGATTCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGCCGCG
GTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATG
GCGGTGATCCCGGAGGTACCACTAACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTATGC
GTCAGAAAATTTGGGAGAGCCGACGTCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGC
GAAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTC
TCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGATTAACGGTCTGACTC
GATTGATGGTGTACCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGT
AGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCC
CAGATCTACCAACGTCTAATCGAAAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATC
CATTTGAGGCAGGAGAGCCAATGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCA
GTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTAC
TTAGGCCTAAGGACCTGTCTTCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTT
CATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAA
GCTCTGGCCCGAGAGATATCGGATCCACAAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCTGGGACCAACAGA
GAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGATCAG
GATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGACGTCATCTACGGGTATAGTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAGAAC
ATGAGGGGATCTGTCATTCAGTCACTTCGTCAGCCGGACACTGAGGCCGAATGAACTGAGCTACGGAGCAGTGGAGAAAAGAGATACTCGCGCTCCTGCG
CGTGTTGGATCTGAAATTACAACCTGTTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGAGTTACA
AGGACGTTTGGGACAGTGGACAGCTTTACTCTCGCCTTAAACACTGGATATTCGAAAGAAGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTC
CTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGATGAGGA
TTTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTATAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGG
GCCAGATCCACTTATGCGGAAGGCCTCACCGTCCCAGCGCGGTGTTTAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCT
GGTGATTTGTGGGGATTCAAATTTAGTGATCAGACAGGTGCGAGGTGAGATTGACAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAATGATGATCCAC
CTGCGTGGTTGGATGAATCACGAGTTGGTGTATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTG
TTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGAT
GGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTTGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAG
AACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGGGATCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGG
ATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAAC
CTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAGCGAATCCGGGAATGTTTTCACTGG
AGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATA
TCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCT
GTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGC
GAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATTTC
GTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTTAAATGAGTA
CGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATGCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTG
GAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGG
TGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCATCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTA
TTTGGATCGAGTGAAAGAAAGGTACGCCCGCAAATTGGCCCATCTATGGCACGGGCCGTTCCGGACAAGCGAAAAGATAGGGGAACATGCGGTGAAGTTG
GAAACGGCAGGTACCGAATATCGTTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGCTGGTCAAGGAATATCCGGACCGGCCGCAAATCCGTATTTCGG
TGGATGAGCCCAACCGGGTATATTTCGACGAAGTCCTCCTACCGGAAGATAGCTGGAATGTGGATCTCGAAGCCGACGAGCTCGAAGTCGAGAGGATCAC
CGATATGAGGTCAGGGAAACGAACTAGATACGGACGGATTTACCGTGAATTTCTAGTGTATTGGCGCGGATATGACGAACCCAGTTGGGTAGACGAGGCA
GATCTGAACTGTGGAGCATTACTCTATGATTGCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGG
ATTCATGGATGTGAGTTGGTCATGTCGATGGGATGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCA
CATCGAAAAGAAAGAGAAGACGGATCCTCAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAACGTTTATGCATAAGAGTGACGTTTGACGTGCGAGGAGTC
CTGTTTGATCTCAAGCACGAGCTTTCAAGGGCCCCAACTATACTGACCCAATTGATCCTGGGTCATTGGCGCTAGATCCGGATGAAATCCAGG