Description :
From Genome Similarity Track
Location :
Scaffold_871:547- 3539
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_871-fgenesh-gene-0.1Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_871-snap-gene-0.6Tripartite motif protein TRIM33 beta

Sequence
2992 bases(100 bases per row)
TGTCATAGCAAAAGAATGATCCACAAACTGAGTTATATCAGCAATGCCAGACTCCAGGTTCAATTCGCCTCCTGATTTGCCACCCGGGATCCGTAGCCCA
TTTTTCAAAGTTCAGAAGCCGTGTGTGCATCTAGATGCAACAAACCAGCACTTCTGGGTACATCTTAGCCAAGCCGCTTACTCCAATGAACGCTGCTCCC
CTCATCTGGGTTTACCAGAAATACCATGTCATTGGTCACTTGCACCTGAATAGTTGTTTACTCCTCAGTGTGGCATCGGTGGATTTTCTTGGTTTTCTGT
TTCGGCTTCAGATCGCAAACCAAATGTCCAGGACAACAAGGACGCGTTCAGCAGCGGTGACACTGAGCCGAAGTGGCAGCAGCAACGGGGGGTCGAAGGT
GCCGCGAATGGCGTCTTTCTAAAGTCGCAAAGTCGCCATGTTTGAGATCATTTTATTGGATCGCCATTCGCCACGATGTCGGTTCGTACTGCAACAAAAT
TCCAACTCATCCCACTGTCCATCACTCTGACACGCCCGCTGTCCAAAAATCCGAACAAGTCATTTGATTTTTCATGTGTCGAGTCAAATCAGAGTGATGG
TAAACCTGTTAAAAAATATACCCTGATATTATCGATTGTAGTTATTTGCGGTTCTGTCCCACGCGGTGTCGCTAATTTGTGTCACAAGCGCGAGTTCCGC
GAACCTGCGAGACTGAATAAAGCGCCCAGCCACGTGTGCGACACCCTCTGCACAAAAGTTACCTGGATTCAGTATGTATCTGTTGGTAATACGACGAGTC
ACGCGTGATCGTACAGTGGAATGGAGGCGCTTCGACGATGTTGGACATTTTCCGATCCTGCAGGTCCTGCGCGCACCCATAAGCGCAAGCGGGTGGCTCG
TAGTCGACCGCGCGCTTCCAAATTCGCATCTCTCGGTCGCTCGGCATTCTCGCATTCGCCGGCTATAGCCCATCCACAGGAGATACAATGTCCTCGAAGC
CACAGTCTTCGGCCGCGTACGCATCGCTGCCTCGACGCCTNNNNNNNNNNNNNNNNNNNGACGTTTACGACCGAGACGGCCGAGCAGCAGTACCAAAGCG
CGATGAAGAGCGTGCAGGAGTACCTGCGCTCGCACATCCCAGCGCACCAAATGGACCTACTCGGTGTGAACGACGCGCGCTCGCGCTACTACTTTGAGGA
GATCCAGCAGTACTTGGCGCACCGCGTGAAGCGCGAGCAGCTGACACAAAGACAGCAGCAGCAGCAGCAGCCACAGCAAGAGCTCCGAGCAGACAGCAAG
CGCATTCAACGGAAAGACAGCGAGCTCCTCGACGACCTGGACGAGTTTCTGAGCGAGCTGGACCCAGCACTGTTCGCAGACCCCGTCCACGACCACCTCC
CAAGCAACAGCGAGAAGGCTCACGTGTCGCAGCTCAAGCGCTCCTGCAGCTACATCAAACAGATGCAGGAAGACGCGTTCATGAAGCGCCACAAGATGGT
GATCAACTAAGTAAGATATGAAAGAACTCAGGTACTGTACCATAGCATAAAATAGAGAGACGAGAGAAAAGTATACACTACGACAGAGAGAGAGAAAAGA
GCATGAGGTCTATTACGCAGCCTATGTACAGCTAAAAGAAACTATTTAATCTAGCAGCAGCAAAGCCCAGGCAGCATTATCATCACCATCATCATCCATT
TTGGGTAAATTTCTCTAATCTAATAATTCTCGCACTTTCTGCGAAAAACGGGAGTATCAACTTAGCGAGTGCGTCGGGATTTTGGTTTTCTTACTGTGGT
GAGTGGGGGCGGGAAACAGCATTAGGCGGAAACGCGCGAGGAAGAGCAAGCGGATGTTTCACGGCCACGCGGCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTCTCGTAGTACTGCGGATGCGTGTGGGAGGCGCTCACCGCGTGTCTCTTTGATCTGATGGTAGCGACAGCTGCGCAAGCCCG
AGCCCAAGCNNNNNNNNNNNNNNNNNATGAGCAAGACGCGCAGCACGGACCCGTCGCCGTTCAACAGCGCGGCGTCGACGCCTTCGTCTGCTGTTGGCNN
NNNNNNNNTGACGCGTCTCTCCTGGGTGCGCTGAGCGCCGGTGTGATCGCGACGGATGCGGTCAGCACGACGGCGGCGATGGGATCGTTTCCGCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGCAGCAGCACCGATATGAGCAACCGCGTGTGCGCATGACAGAT
CTCCATTCTGGTGTCGTGTATCCACATGCCAAGCAGTCGGCGTATCATCAGCAGTCTACGTATCCAGGTCGGCCGCCGCAAGCAGACCAGCCCCAAAGAG
GGTTCTATGCGGAGATGTATCAAGATCAGTTGGAGCTGAACGGCTCGATCCTCGCGGAGACCATGTCAATGGCGTTCAAGCAAATGGTGGCTGAGCAGGA
CTGCTGCTTCATCGCCAAGGGGATCTGCCACATGTGCGGCACGAACGAGCGCCATTTGATCCCAGTGGTCAATTTCTGTCCAGAGTTCCACGTGAACCAC
TCGCTATGTCGCGAGCACTTGCGCAGCATGCACCGTGTGCGCATGGAGGACATCTTTGCTGGGAAGAATCGACCCACCGTCAGCAAACGGTCTCTAAAAT
GCATGGTATGCAGCCGTTCATGTCCGTGCTCGACGTGTCAGTTGGAGAAACAGCACGAGATCAACAGATACAAGCGGTGGCTCGCGGGGGAGCGTGAGTA
TGAGCTTGATAGCGAAGACCAGTCGATGGAGAGAGACCGGGGCCACCATTACATTCGAGCTGCGAGCCTTAGCAAAAAACCACACAGTACTATCATTTCA
ACTGGTAGTGAATATCTTGTGGACACCAGTCGGCAGCACGACCGAAACTATCACCGTCATCAAGTACCGCCACAGCCACCGAGACNNNNNNN