Description :
From Genome Similarity Track
Location :
Scaffold_2368:547- 2720
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2368-snap-gene-0.1Mdc1 protein

Sequence
2173 bases(100 bases per row)
CAGATTGCTCAAGAAACAAGGCAGTACATTGATGCTATGCAAGCGGAAGCACGGAATGAGCAAGAGCTGATCGCATTACAGTCACAGATTGTCCCTGGTG
AAGGTTCCTCGCCGTTGGACCTGGCTGCAGAAAAGCTGTTGCTGCATGGTGAAATCAGCGTCGTCGCAGTGAACGATTCATTGGTTGCAGCGAAGCAATC
CTTTTCTGATCGCCTTGAAAAGCGATATGCGCACTGTTTTGAGAGTGGGAAACTGATTTACAGCAAGCACGAGGTGGATGAACGCGATGGCCCAAGCGCC
GATCGTTTCGCTATCCAAGGATGCATTGAATTGAAGCAAGATGCTTTCTTTTTAGAGTTTGTACCGGATGCAGTCTTCTCGAGCGGGGTTACGAAAGGAT
GCTTTGCGCTCATCTCGAGCAACGAGAGTGTCGTGTTTGGCTTTGAGGATTCCATACTCGGACAGTCGTGGGGCCAAGCCGTGAGGTCGATGCTGAGCCA
AAATGAAACTAAAAACGTCGTACTGCGCAACGAACGCACATTTGAGGATATGAAGATCCCTCAGCACGTTGCCAAGCAGCTGAAGTACAAGAAGAAGTCT
TTTGCGGTGTTCCCATCTTTCCATGACGACGATTTACCAGGTATTTTCTGGATGGAAGCCAGACCAGGTAAATGGGAGATCGTGGAGTTGATGTTTTATG
AGCACTGGCTGTTGATTTTCACGATGAAAGGATGGAAGCAGCACACGCTAGCTCGTCGTGTGGATACTCAAGACCCGAGCATCGATGTCAGCGATCAGCG
AAGTGGTGAACACGACTGGTGTCTGGTGATATCTATGAGTCACGAAGCGAAGGACGAGGTTCGGCTGATCTCAAAAAGACGCTCGCGAATAGACTTTTGG
TACGATCAGATATCAAAAGCAGTCGCAACGGGCAAGAAAGCAAAAGTGGACAAGCAGATCGAAGAACAGCAAACTCTGGGAAAATCTGTTGGCTCTGAAC
AACAACCATTCATCAACGCCCGTGCCAAAAAGAATAGGAAACACGCAGAAGCAGTATCTAGAGAAAATCCTGCTTCAGACTTTCTTGCTGTGGCCGATAA
ACCTGCGGAAGGTCTAGCTACAGCTACGAAAGCAACGCGGAAACGGAAAACCGATGAAGTTGAGCAACAAAACAGCGACAAATCAAGTACTTCAGGTGTG
GAGAAACCAGCCAATGCAGCGAAGAAAAAGGGCGTGACTCCGGCGAAGCGGAAGAAAGCCGTATCAAGGATAGATTCATTCGTCCAAGTGGCGCAAGAGG
CACTAGACGGTAATGGAGACACTGCTCCAAGTGCCGAAAGTAAGCCAAAGCGAAGCCGCAAGGAACTTGCCAAGAAATTGGGAGAAGCTTCCATTCCTGT
AATGCAGTCTTCTGCTATTAAAACTCCCAAGCGACGGTGGCTGAAGCTGAAATCTGAGGATCCGGACGACTCCATCCTCCTCGATACTGAACCGAGCCAA
GACACATCAATCGAAGAGCCAACGAGCAACGCTGTCGTCCCAGGGAGCGGATCGCAAACTACGAAAGATGGGATTCGGATCATCTTGACCGGAATAGAGC
CGACTCCTGCGATTCGGAAGAAAATCAAAGCGATTGCGAACGCGGTGTATGAAGATGATATCGAGAAAGCCACACACGTCATCGCGCCAAAGAACCAGCT
CAAGCGCACCGTCAAGCTGCTCTGTGGGATCTCACGCTGTCAGCATATTTTGGACATGAAATGGCTCGACGAGTCCGCTCGCGTAGGTGCCGCTCTGAAC
GAGGCCGACTACTGTCTGAAAGACACGAATGCGCAACAAAAGTGGCATTTCGACCTGCATAAGACCATGTACGAGTTTACACCAGAGCAAAGACGCCAGC
TCTTTGTCGGCCACACCGTGTTCATCACGAACCACAAGTCGGTGTTGCCTCCCGTGAAAGACCTGGTAAAGATCGTAGAGTGTGCGGGCGGCAAGGCCGA
GGTGAAAGGCAGTGCTGGTCCGTCGGACTTGGTGATCACAAGTGAAGCCGCGTTGGGCGTGGCGTCGGTGCAAAAGTCGTTGGTGAGTGCGAACCCGCAG
CGGATCTATTCACCGGAGCTGATCCTGAGCAGCATCCTGCAGCAGCATATCGATTTCGAGCAGAACCATCTTG