Description :
From Genome Similarity Track
Location :
scaffold_15:546920- 551745
Transcript NameFunction/comments
g1468.t1 hypothetical protein PHYSODRAFT_261139
g1469.t1 hypothetical protein PHYSODRAFT_476855
g1470.t1 conserved hypothetical protein

Sequence
4825 bases(100 bases per row)
CGAAACCCTCGAGCTCCTGACTCTTCCGGCGAGCGCACTCGATCACTGACGAAGGAAACCCCGCCATTGAAGCCACGTGAACACCAAAACTCTCCATGCA
AGGCCCGTCGCGCACCTGGTACACCATCGTGATCTCCTTGTCGCTGGCCACGGCGGTAACGTGCTTGTTGGCGAAGCCTTGCGGGTGCTCTTGGTGCAGC
GCTGTCAGCTCGTGGAAGTGTGTCGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGCAGGTACTCTGAGATGGCCCAGGCCAGTCCGAAGCCATCGTACG
TGGACGTACCTCGGCCCAATTCATCGATAATCACCAGCGAGTGCTCCGTAGCCTTGTGTAGAATAGCCGAAGCCTCCAGCATTTCCAGCATGAACGTAGA
AACACCGCGTTGTTGAAGATCGCCCGCACCAACGCGCACCAACAGCTTGTCGAACACAGGCAGCCTCGCGACTTCTGCAGGCACAAAACTACCGATTTGT
GCCATCACAGCAATAGTGCCCAACTGACGGATGTAGGTACTCTTACCGCCCATATTAGGCCCGGTCACAAGCTGGAAGCGCGATTTCTCGCGCTCAAAGT
TGTAGTCGTTTGGAATGAAATCGACTCCATCCTGCAGCTCCACACAAGGGTGGCGCGCACCTGTCAATATGACGCAGTCTCCATTTTTCTCCATAGTAGG
GCGACAATAGCCTGAGCCAGCATGGCATGCCGCGTGGGCGAATCCAAGCAGCACATCCAATTCTGCCAGTGTTGCAGTCGCAGCCTCGAGCACAGGTACG
TATGTGCTAGCCACATCAATAGCCGCGTTCAGCAAGTGCGCTTGCCGCTCCTCGTATTCGCCGCGCACACGGCGGTACTCGGATGCCAGGCCCTTTAGCG
TCGTTGTAGTGAATTGGACTCCGCTCACGAGGACTTGGCAGATATGCACCTGTGGCATCTTGGACAACCGTGCCTCCTCCTTCTTGTTGGTAACACGGAA
CGCGAATCCGCGCACCTTGTCCTTCTCGCACTTGATCTCACCACCAATCGTATCGAGTGCATTGCGGTGTTCCTCCTCAATGTCCGCAACGATGCCATCC
CACTCCTCACGCAGCGCCTGGAGGTCCTTGTCATGCTTTGCGTTCACCACAAGGGTCGGACGGCTGTCCAGATCGACAACCTCCTTCACAAGCTCCGTGT
AGCCTTGCAGATCCGCAAGCTCCTTCTCCAGTGGAGCGGCAAACTTCTCCTTCACAAGAGCGGCCAAGGCCGTATCTCCACCCGCCTCCGTGTTTTTCAG
CAGCTTCAGCACGCGCGGCATGGCGCCGACAGCAGCATCGTACACACTTACGAGGTCCGTAATCTTTGCATTTTTCTTGCGTTCAAGGCTGACCGCCAGT
CGCCCCAAGTCCGGCAGAGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAACGACGAGTCGTCCACAAAGAGCTGCACGAGGCTCTGTCTCGTCTCGA
TCTGCTCGACATCCAGCAGCGGCTGTCGGATCCAGCGTTCCAGCAGACGGCGTCCCATGGGCGTCTTGCCACGGTTCAGGATCTCCAGCACGCTGCCTCC
GAACCTCACCCCCGTGGTGGTAGCGCTGGGCTCCGGCAACAAGTTGAGCGACCAGACGGCAGCGCTGTCAAGCTGCATGGCTGACGCCAAGTTGCCCTGG
CTCAGTGTGTAGCAGCCAAAGGTATCGGCGTCAGCCATGACGCCCAGCGCCTCGATCAAACAGGCCAGTGAGCCCGCCGCCAGCTTAGACGAGAGCACGT
CCTGGTACTCGGCCATGGTACCGGCTCCCAGCAACCTGGAGACGTTGGTCTCGAGGCCGTTGGCGTCGCTGAAGAGCTGCTTCTTCCTGTACACTGCGGC
CACGTCGTGGGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCGTCGGCTCCAGCTCCGCCGACAGGAAGCACGTGGAAGGCGCCAGC
TGCAACAACAGCGACTCGAGGTTGGCCAGCGCGCTCGAGTCGGAGAAGGAGAAGAGCACGAGCTCCCACTGCTTCCTGTCCTCGCCCGCCTGGCCCTTGA
CGCATGACGCGCGGGCGCGCGGCCGCCGCACCGCCACGCCCACATGCTTCAGGTGCTTGTCGTTGCGGATTTGCAGTGCCACCTCGGCCTGCGCTTCGTC
CAGCAGCACCACGGACGAGTCGTCATCTTCGCGGTCGGCCATGGTCTCCTTTCGGACAATTCAAGAGTGAAGGTCGGTTCAATAGGCGCTTCCCGCGCTT
TTCTCTGTCCGGGTTGAAGTGTCGCAATGTGACTTCTTCAAGAGAGAATGGGTCTTTTGACCTCGGACACTTTCGACTTGCTCAGAATGGCGACGGATTG
GCGTGCGGAGTACGTGAAGGCGGCGGCGCTGGGGGACGCAGGAGACGCTACTGGGGACGTTACAGCGGTGCAACAGACGGAAAAGACGCCGGTGGGCGGT
GTGCTGGCGTTTCTGGACCTCCTGCTGACGCAGGAAGGCGGCGAGTGGTGGACCAAGCTGCAGAGGAAGGCCAGGCGGACGGCTGCCAAAAGTGATGGTC
AAACAGTGGACGCAAAGGACCAGAAGCAGCTGACGGCGCTCAAGACACGGCTTGCAGCAGTGGGGACGACACTCGTGCTGCAACTGCCGCATCTGAACGC
GTCTCTGAGCAAGGAAACGGCCAGAGTGCGCGTGCTGCAGCTGCAGCTTGTGTGCCGTATGCTGTGCTATGCAGTGCTGATCAAGAAGAAGGAGAGGAAA
CTGCTGAAGAAAGAGATTCAAGGATTAATGGACCGGGTGGCTCTGCTGCTGGATGCGGCGAACCCGCCGTCGCTGGCGGATGAAGACGCGGATGAACGCT
CGCCGTTCCAGGAGTTCCTGAAGCAGCAGTTGGCTCCCAGACTCGAGCTGCTGTTGCCAGAGTTGATGCAATATTTGCTGAAGGCATACGAGATGGAAGT
GGAGGAGAACAAGGCCGAAGAAAATGCGAAGGACTCCAACTTGCTCTTACCGACCGTGAGTGCTGGTGTTATCTCCCTGGTAGAGCTTTGTATGTGACGC
TGATCACTGATGTTTGTGGCTTGTGTGCAGTTGCTACCGGTGGTGAAGCCTCCTCAGTCACCTGCAGAGCTACCGACTTCTGTTGCTAGTGGCAATGGTA
GTATTCTGTCTGCGTTACGCCAAGAACGGCCAGCAAAGCGTGCTCGCCCCGAGGCTAGCGAGTTATTCAAGGAAGTCACGCTCCCGCATCAGTTGCAGCG
GAGGCAGAAGCAATCTCACCCTCGGAAGTCGAGACGGGTGACCAATAGCCACAGTAGCGGCGCAAGTAAAAGCAGCCAGGGCTCACTGCTGCGCGCGGCG
GCTGGTACTACATCACTGCACGCACCAAGAAAGCTGGAATTTGCGGGCAAAACAGCTTTGTACGGCGCAGCTTCAAGTGCGAGACAACCTGGCCAATCGA
ACTTGCTGCGTCGTGCCGCTAATCCGTCCGCGCCAAAGGGGCCTGCAGCGCCCTTGCTCCAACGAGCAATGTCGGAGCGCTCTCACTTCCATGGCCGCCA
AACGCCAATAGGTTCATCGCCAGGTTCTGCTGCACAAGATGCCGGAGTCGCTACAGCTGGCAAAAAACAATCTCCTGGATCTGCATTACGGCGCTCGCAA
ACCACTTCATCGGTAGTCATGCGAACTCCAGACAGACCGAAAAGAATGGCAGCACGAACCACGAGGCGCGTGCTCGTCGAAGCATCTCCTCCACTGCGCA
GGCCCACCGCAGCCGCTGTGCCTCGTCTTCTTCAGCCCAAGTCGTCTCGGCCAGGTTCCAACCCACCTCCTCTTTTCCGGTGACGGTGGCACGCGACCCG
AATAATAGACAACGAAGACTTTTAAGTTCATCGGCATTGCCTAGCCATTACTATCTCGTGTGACTGTTGTTGTCATCGCTGTCGCTGTCGCTGCCATATC
CCACCAGTCCCAGCGCCGCCGTATTCGGCTTCTCCTTCTTGGCAACAGGTGATGTGCTGGTGTCTTTTGGCTCGACCTTCTGCTTCTTATTGTCCGGTTG
TTCCTTGGTGGCATCACAACTCTCGGCAGCCTTCGTGCCAGCCTTACACGGCTTATCCTTCCCAGCCTTTCGCTTGGCCCGCACCACCACGACCGGGGTC
TTCTTGCCTGCCACCTTCACATCGTCTTTCACCGGATACTTTTGCAGGTGCTGCGCTGTAAGTCCCGTCCCAGCGGCGGTCTTAGGCGCACCGCGTGCCA
CCACTACACGCACCAAACACAACTCGTCGATCAACACCAACATTAAAGCCACCAATAAACCCTTCTGCCTTACGGAATTGCGCCAGGTCTTCTTCATGTT
GCGTCTGGCGCCTCCGTTGAACGTCGTCCTTCTTACTCTCCAAGTCCCGAATGTACTCGAACTCTTCCTCATCCAAACCCTTCGGGGGAGCTGTGCAGCC
ATAAAAAACGAGTTCGAATTAATTACCGCAGCAACCACAGCCACAGATGCCACGCACCGAAGGGATTGTTCTTCTCCTTCCAGTCGCTGTCCTTCTGGTC
TTTGCGCTCTTGTAGCTGCTCGTACAGCGGCTTGTAACCTGCCGCGTCCTCTGCTCGAGGCGCGGGCGCCTCCGTCACGCGCTTCTCCTCCACATTGTCA
CCGAAGAGCTGCAAACATGAGCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAA
GTGGACACAAAGCCCGCCAGAGACG