Description :
From Genome Similarity Track
Location :
Scaffold_249:54678- 56989
Sequence
2311 bases(100 bases per row)
CCCCATCCTTTTGTTGGAAGACCTCGGTGGTTCAAGTCCAAGATACTTTCAGGCGAGTAAAAATTAGGGCATAAGCAAGAACAGATTCTAGAAGTCAAAA
GAAAGGGGGGTATTAAATACTACTACTCAATCTGCGGTCAACGTGGCAAGACTTCGTCACGCTTAAAAGAATTTGTAAGTCTGCCTCCCTGTCTAGGAGA
AGGGATACACTCTGGCTCCCCGTTGAAGACAGTCACGTAGCAAGAACAAGGTGCGATAACCCCCCAGGAAGTATATGGCCTGTGATTTCACCTTGTTTCG
CACCCCATAAAAATCCGCTATCGGAAGCAGCCTCCCCACCTAGTGGTTCTGGAGCAACGTAAAGGCCAGGTGCTTAACACCTTTGCAGCTGCCAGGGGGA
GAAACTCCCTGAAGAACTTGGTTGTAAGTCCATTCTCGAACAGTCAATAGAGCCGCCACCTACTGGCCCACCCCAGGACTGCCCTATTTAAGGCTGACAT
CTACATTCTAACCCTTATCTTCTGAGGAGTGCAACCTTCCAGCCGACGGGTACACAACGTAATAGAAGGTCCATACGCGGCGTCGGGGTACCCCCTCTGC
AAGTCGCCAGTCCGGCACAGTAAGTGTGTGGGATCTCATCACACATTTTTAGGAACCCACTTGACCACACCATCGTAACCTTTGCTTTTCTTTGAAGTCT
TATAGAACCTTTCGCATATTCATGTCGCATGTTCTGGTCCCACACAAAGTTCCGCCCGTACTAAAACCATCCTCTGCAATTGCATTCATTGGAGCGCAAT
TAAGCGGCATGCGGGATCTGGTCGGCAATCGCAATCTCATATGGTCATCTTTGATCTTTGTCTCTATCGAATCATTTTAGGTGAATGACCTTGGGATGGG
ATCTACCCGTTAGATCTCCCAATGTAACGACGAACGGTGACGAAAGTGCAAACAGGCTGACTCCTATTCCATAAATCAGATGTTGTCTCATTTTCAATTT
TGAAAACGAGGTTTGCGTTTTACAATTCTCGATCTGATTTGCCACGAATTGGCTTATTCCGAAAGTGTATCGCACTACGTATAATGCGTGGGCCGCTTGG
ACGTCTTGGGATCTAGTTGTCTCGTATGCATGGCACAATTCACTGGAGATGATTATAAATAGGTGTAGAAGCTTGATAAACGGGTCCACAGCCAGACGTA
CGGGAAGACATATGTCAGTAATTTGCACCGGGGAAAGGAGGAAGAGTTGATGAATAAAATCCATATACAACATATTTAAAAATCTAGCAACAGCTCTTTT
TCCTTCAGGGTGGACCTAGAATTATCGCTATCATTTTCGGATCCATTTCGAATCTTAGGCCCACGTAAACTCAAGAGCACAAAGCATTTGAGCAACTTAT
CGATTTGAGCTTTGAAACTTGGATTATGGACGAAAACAGAGTTTTTATCAAACTAGAACCACCCACTCCTGCGGTATCCTCAAGTGTGTAACTCCAATTT
CGCATGCTTCTCTACCGGACTACATGATCAGGATTACATGAAGTGGACTGTATACGTGGCGCAAGTACCCAAAATAAATGTTTTGGGCTACAGCGATACT
AATGGCAAAATTGTATCTGCCGCTTGCAAACGAGATGACTTTACCACTTCAGATGACGCTGCTATTCGGACCCGATGAAATAGATAAGCAACTATTACTG
GAGGTCCAAATGACCTAGGGTGCATACGGGCATCGTACCAATAACCCGGGTTCAGAGCTATCCCTATTTGTTCTTCATTAGGCCAACAACACTTTGTACT
GTGTAATTGACCGTATAATTAATTTGGAAACAGCTATAGAACTGGAGCTGGTTCACATTCTGTAGCTTGAACGAGAGAAGGCGGTCGTGTTCTTGGCACA
CCCGGCTTAAATGGTTTTTGTAGGGTCTCAAACAGTCCGTCGACAAAAACACCTTATATGTCGCTTTACAACGGAATTCATTTTACTAAGCAAACTGCAA
TATACCCTCGGCATTTGATCAACTATTACCAGGCTACGAAGCCGAAAAAGCTTCGAAGAAGGCGCTAGCTTACCGATTGAACAAGATACAACAGACCTCC
AGTGTCATCGCCATTAACTAATGGCATTTTAAGTCTGGGTTTGCTACAAAGTTGCTTCACACCAATCGAATCTTTACTACCGGGTAAGGCTACACGATTC
AACGTGAAAGTGTCATCACTCTTGAACGGGTATCACGAATTATTCATACATATCTTTTAGCCCTGAGGAGGTGCATGTAAGAAATGCTTTCATATTATGA
ACAGAAGAACC