Description :
From Genome Similarity Track
Location :
Scaffold_113:5467- 7624
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_113-snap-gene-0.7Lectin domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_113-snap-gene-0.13Udp-d-glucose 6-dehydrogenase

Sequence
2157 bases(100 bases per row)
ACCACGTGGCCGTCTATTCGAACGGCCCACAGGCCAACTCGCTGCTCGAGAGAGCGCGCATATCGGCCACCGTGCTGCAGGATCTCGCGGATGGCAAGGT
GCACGCAGTCAAGGTCCGCTACTACAACGAGCTCAGGGTGAGTCAGCTATATCATCTCGACTGCATCCATGCTTCGCTTACCAATTTGCCTGGTATAGTA
CGAGTACGCGCCGTACTTCTCGTCGACGACCGACCTGGTGCAGTTTATCAAGGACGTGTCCGAGGGCCGCCGTGTGGGCACGCTCGTTGTATTCATGGAC
GATGGCATCGCGAGCGACACGCCGATCCTCGCGATCCCCATTAACCTCGCGGCCACGCTGCGGCTGCAGGCGGACGAGGCCTTCGTGGTGAGTTTCATGC
GGTCGCTTGACTTGGCTATTAGCTACGTAGACTTGGACTGACTGGAGTGTGTTGGGTGGACAGGGATTCACGGCATCCACGGGCAACTCGTGGCAGAAGC
ACGACGTCCTGGGCTGGTATTACTGCACGCAGCCGCCGTGTCTGGACGAGTACGGCACGGAGATGGCGTTTGAATTCGACTACAATCAGCAGTCGATGCT
CAGCACGGCCTCGCACGCCAAGAGCCTCTACCCGATCTACATCTACTCAGACACGACACCCTGGGCCAAGCGCCAGACGTACTTTGCCGCAGGCCAGACT
ATTGGACTGGTCTCGTAGAGTAAGAACGCAGAGCTTCAGTCAACTACTTGTCAACATGTTGCTGCTGTTACTCAATAAATCAATCAAAATGCAAGAGCTC
GGAGTATGTTACCTGGTAGAGCAGATCAGCGAACCACCTTCCCGATAGCGTGCACTTCAGCGCCTAGCTCTCGGAGTTTACCGTGCGGCAGCGAATTGCG
TCCATCGAAGAAGAATGCGGGCTTTGCCATTTGCTGGTAGATCTTCTCGTAGTCCAGTGCCGCGAGTTGCTCCCAATCGGTCAGTACGCACACGGCGTGG
GCGCCTCTCGCGGCTGCGTACGGTTCCGAGAAGAACTCGAGCCGTTCGCGCCAGTCGGATTCATGCATGCCCTGGCGCTCGAACTCTGCGAGCATGTCTT
CTTGGCGCACGTGTGGGTCAAAGACCGCGATTTTGGCGCGCTCGACTAGGAGCGCCTGGATGATCGCGCCGGCAGCCGTCTCGCGCGTGTCACCTGTGTT
CTTCTTGTACGCGAGTCCGAAGATGCAGATCTTCTTGTTCGAGACCGAATCGAACATCGAGTGCACGATCTTCTTTACGAACCGGTCTTTCTGGAAATCG
TTGATCGCGACTACACGGCGCCAGTACTCGGCGACCTCGGGCAGGTTGAGCGTCTCGGCCAGGTACACGAGGTTGAGCACGTCTTTCTGGAACGACGAGC
CACCAAAGCCCACGGACGCGTGCAAGTACCGATGCCCGATGCGCTCGTCCATGCCGACTGCGCGCGCTACTTCGCGCACATCGGCGCCCGTGGCCTCGCA
GATCGCTGAGATCGAGTTAATGCTGGAGATGCGTTGCGCCAGAAAGGCGTTCGCGACCAGCTTGGAGAGCTCCGAGGACCAGATGTTGGTCGTCATGATC
TTTTCTGTTGAGGTGCCACATTTTGATAGTGTAAGAGAGTGAGTCACAGAAAGCCATGGTACAAATGATATGTCGAGAGTCAATAGCATACCTCTTGGCA
CCCAGTGCGAGTAGATCCACGCGAGTTTCTCGACTGCCGCCTCGCCGCGTGGCGTGGACGCGCCGCCAATCAGCAGTCGATCAGGCGTCTTTAAGTTCGC
CACTGCCGAGCCCTCGGAGAGGAACTCTGGGTTGGAGATCACCTCGAAGCGCACGTTATTGCTCGAGTTGGCGTTGAGAACTTCGTTCATCGCCGCGGCC
GTGCGCACGGGCACGGTCGACTTCTCCACGACGATCTTGTCGCTCGTGGCGAACCGCGCGATCATGCGCGCACAGTCCTCGCAGTTGCGCGTGTCGGAGG
CGCTGCCGGCGCCCAGTCCGCTCGCCTTCGTGGGCGTGTCGACGCAGACGAAGATCATGTCGGCCTCCTGGATGCTGCGCTGTGCGTCGCTCGTGAAGAG
CAGGTTCGCGCCGCGCGTGCTCGTGAGCAGGTCGTGCAGCCCTGGCTCGTAGATGGG