Description :
From Genome Similarity Track
Location :
contig_15:546662- 551476
Transcript NameFunction/comments
g4278.t1XP_009517071.1 hypothetical protein PHYSODRAFT_261139 [Phytophthora sojae
g4279.t1hypothetical protein
g4280.t1POM59712.1 hypothetical protein PHPALM_31514 [Phytophthora palmivora var. palmivora

Sequence
4814 bases(100 bases per row)
CGAAACCCTCGAGCTCCTGACTCTTCCGGCGAGCGCACTCGATCACTGACGAAGGAAACCCCGCCATTGAAGCCACGTGAACACCAAAACTCTCCATGCA
AGGCCCGTCGCGCACCTGGTACACCATCGTGATCTCCTTGTCGCTGGCCACGGCGGTAACGTGCTTGTTGGCGAAGCCTTGCGGGTGCTCTTGGTGCAGC
GCTGTCAGCTCGTGGAAGTGTGTCGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGCAGGTACTCTGAGATGGCCCAGGCCAGTCCGAAGCCATCGTACG
TGGACGTACCTCGGCCCAATTCATCGATAATCACCAGCGAGTGCTCCGTAGCCTTGTGTAGAATAGCCGAAGCCTCCAGCATTTCCAGCATGAACGTAGA
AACACCGCGTTGTTGAAGATCGCCCGCACCAACGCGCACCAACAGCTTGTCGAACACAGGCAGCCTCGCGACTTCTGCAGGCACAAAACTACCGATTTGT
GCCATCACAGCAATAGTGCCCAACTGACGGATGTAGGTACTCTTACCGCCCATATTAGGCCCGGTCACAAGCTGGAAGCGCGATTTCTCGCGCTCAAAGT
TGTAGTCGTTTGGAATGAAATCGACTCATCCTGCAACTCCACACAAGGGTGGCGCGCACCTGTCAATATGACGCAGTCTCCATTTTTCTCCATAGTAGGG
CGACAATAGCCTGAGCCAGCATGGCATGCCGCGTGGGCGAATCCAAGCAGCACATCCAATTCTGCCAGTGTTGCAGTCGCAGCCTCGAGCACAGGTACGT
ATGTGCTAGCCACATCAATAGCCGCGTTCAGCAAGTGCGCTTGCCGCTCCTCGTATTCGCCGCGCACACGGCGGTACTCGGATGCCAGGCCCTTTAGCGT
CGTTGTAGTGAATTGGACTCCGCTCACGAGGACTTGGCATATATGCACCTGTGGCATCTTGGACAACCGTGCCTCCTCCTTCTTGTTGGTAACACGGAAC
GCGAATCCGCGCACCTTGTCCTTCTCGCACTTGATCTCACCACCAATCGTATCGAGTGCATTGCGGTGTTCCTCCTCAATGTCCGCAACGATGCCATCCC
ACTCCTCACGCAGCGCCTGGAGGTCCTTGTCATGCTTTGCGTTCACCACAAGGGTCGGACGGCTGTCCAGATCGACAACCTCCTTCACAAGCTCCGTGTA
GCCTTGCAGATCCGCAAGCTCCTTCTCCAGTGGAGCGGCAAACTTCTCCTTCACAAGAGCGGCCAAGGCCGTATCTCCACCCGCCTCCGTGTTTTTCAGC
AGCTTCAGCACGCGCGGCATGGCGCCGACAGCAGCATCGTACACACTACGAGGTCCGTAATCTTTGCATTTTTCTTGCGTTCAAGGCTGACCGCCAGTCG
CCCCAAGTCCGGCAGAGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAACGACGAGTCGTCCACAAAGAGCTGCACGAGGCTCTGTCTCGTCTCGATC
TGCTCGACATCCAGCAGCGGCTGTCGGATCCAGCGTTCCAGCAGACGGCGTCCCATGGGCGTCTTGCCACGGTTCAGGATCTCCAGCACGCTGCCTCCGA
ACCTCACCCCCGTGGTGGTAGCGCTGGGCTCCGGCAACAAGTTGAGCGACCAGACGGCAGCGCTGTCAAGCTGCATGGCTGACGCCAAGTTGCCCTGGCT
CAGTGTGTAGCAGCCAAAGGTATCGGCGTCAGCCATGACGCCCAGCGCCTCGATCAAACAGGCCAGTGAGCCCGCCGCCAGCTTAGACGAGAGCACGTCC
TGGTACTCGGCCATGGTACCGGCTCCCAGCAACCTGGAGACGTTGGTCTCGAGGCCGTTGGCGTCGCTGAAGAGCTGCTTCTTCCTGTACACTGCGGCCA
CGTCGTGGGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCGTCGGCTCCAGCTCCGCCGACAGGAAGCACGTGGAAGGCGCCAGCTG
CAACAACAGCGACTCGAGGTTGGCCAGCGCGCTCGAGTCGGAGAAGGAGAAGAGCACGAGCTCCCACTGCTTCCTGTCCTCGCCCGCCTGGCCCTTGACG
CATGACGCGCGGGCGCGCGGCCGCCGCACCGCCACGCCCACATGCTTCAGGTGCTTGTCGTTGCGGATTTGCAGTGCCACCTCGGCCTGCGCTTCGTCCA
GCAGCACCACGGACGAGTCGTCATCTTCGCGGTCGGCCATGGTCTCCTTTCGGACAATTCAAGAGTGAAGGTCGGTTCAATAGGCGCTTCCCGCGCTTTC
TCTGTCCGGGTTGAATGTCGCAATGTGACTTCTTCAAGAGAGAATGGGTCTTTTGACCTCGGACACTTTCGATTGCTCAGAATGGCGACGGATTGGCGTG
CGGAGTACGTGAAGGCGGCGGCGCTGGGGGACGCAGGAGACGCTACTGGGGACGTTACAGCGGTGCAACAGACGGAAAAGACGCCGGTGGGCGGTGTGCT
GGCGTTTCTGGACCTCCTGCTGACGCAGGAAGGCGGCGAGTGGTGGACCAAGCTGCAGAGGAAGGCCAGCGACGGCTGCCAAAAGTGATGGTCAAACAGT
GGACTCAAAGGACCAGAAGCAGCTGACGGCGCTCAAACACGGCTTGCAGCAGTGGGGACGACACTCGTGCTGCAACTGCCGCAGCTGAACGCGTCTCTGA
GCAAGGAAACGGCCAGAGTGCGCGTGCTGCAGCTGCAGCTTGTGTGCCGCATGCTGTGCTATGCAGTGCTGATCAAGAAGAAGGAGAGGAAACTGCTGAA
GAAAGAGATTCAAGGATTAATGGACCGGGTGGCTCTGCTGCTGGATGCGGCGAACCCGCCGTCGCTGGCGGATGAAGACGCGGATGAACGCTCGCCGTTC
CAGGAGTTCCTGAAGCAGCAGTTGGCTCCCAGACTCGAGCTGCTGTTGCCAGAGTTGATGCAATATTTGCTGAAGGCATACGAGATGGAAGTGGAGGAGA
ACAAGGCCGAAGAAAATGCGAAGGACTCCAACTTGCTCTTACCGACCGTGAGTGCTGGTGTTATCTCCCTGGTAGAGCTTTGTATGTGACGCTGATCACT
GATGTTTGTGGCTTGTGTGCAGTTGCTACCGGTGGTGAAGCCTCCTCAGTCACCTGCAGAGCTACCGACTTCTGTTGCTAGTGGCAATGGTAGTATTCTG
TCTGCGTTACGCCAAGAACGGCCAGCAAAGCGTGCTCGCCCCGAGGCTAGCGAGTTATTCAAGGAAGTCACGCTCCCGCATCAGTTGCAGCGGAGGCAGA
AGCAATCTCACCCTCGGAAGTCGAGACGGGTGACCAATAGCCACAGTAGCGGCGCAAGTAAAGCAGCCAGGCTCACTGCTGCGCGCGGCGGCTGGTACTA
CATCACTGCACGCACCAAGAAAGCTGGAATTTGCGGGCAAAACAGCTTTGTACGGCGCAGCTTCAAGTGCGAGACAACCTGGCCAATCGAACTTGCTGCG
TCGTGCCGCTAATCCGTCCGCGCCAAAGGGGCCTGCGCGCCCTTGCTCCAACGAGCAATGTCGGAGCGCTCTCACTTCCATGGCCGCCAAACGCCAATAG
GTTCATCGCCAGGTTCTGCTGCACAAGATGCCGGAGTCGCTACAGCTGGCAAAAAACAATCTCCTGGATCTGCATTACGGCGCTCGCAAACCACTTCATC
GGTAGTCATGCGAACTCCAGACAGACCGAAAAGAATGGCAGCACGAACCACGAGGCGCGTGCTCGTCGAAGCATCTCCTCCACTGCGCAGGCCCACCGCA
GCCGCTGTGCCTCGTCTTCTTCAGCCCAAGTCGTCTCGGCCAGGTTCCAACCCACCTCCTCTTTTCCGGTGACGGTGGCACGCGACCCGAATAATAGACA
ACGAAGACTTTTAAGTTCATCGGCATTGCCTAGCCATTACTATCTCGTGTGACTGTTGTTGTCATCGCTGTCGCTGTCGCTGCCATATCCCACCAGTCCC
AGCGCCGCCGTATTCGGCTTCTCCTTCTTGGCAACAGGTGATGTGCTGGTGTCTTTTGGCTCGACCTTCTGCTTCTTATTGTCCGGTTGTTCCTTGGTGG
CATCACAACTCTCGGCAGCCTTCGTGCCAGCCTTACACGGCTTATCCTTCCCAGCCTTTCGCTTGGCCCGCACCACCACGACCGGGGTCTTCTTGCCTGC
CACCTTCACATCGTCTTTCACCGGATACTTTTGCAGGTGCTGCGCTGTAAGTCCCGTCCCAGCGGCGGTCTTAGGCGCACCGCGTGCCACCACTACACGC
ACCAAACACAACTCGTCGATCAACACCAACATTAAAGCCACCAATAAACCCTTCTGCCTTACGGAATTGCGCCAGGTCTTCTTCATGTTGCGTCTGGCGC
CTCCGTTGAACGTCGTCCTTCTTACTCTCCAAGTCCCGAATGTACTCGAACTCTTCCTCATCCAAACCCTTCGGGGGAGCTGTGCAGCCATAAAAAACGA
GTTCGAATTAATTACCGCAGCAACCACAGCCACAGATGCCACGCACCGAAGGGATTGTTCTTCTCCTTCCAGTCGCTGTCCTTCTGGTCTTTGCGCTCTT
GTAGCTGCTCGTACAGCGGCTTGTAACCTGCCGCGTCCTCTGCTCGAGGCGCGGGCGCCTCCGTCACGCGCTTCTCCTCCACATTGTCACCGAAGAGCTG
CAAACATGAGCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAAGTGGACACAAA
GCCCGCCAGAGACG