Description :
From Genome Similarity Track
Location :
contig_15:546661- 551475
Transcript NameFunction/comments
g4091.t1XP_009517071.1 hypothetical protein PHYSODRAFT_261139 [Phytophthora sojae
g4092.t1hypothetical protein
g4093.t1hypothetical protein

Sequence
4814 bases(100 bases per row)
CGAAACCCTCGAGCTCCTGACTCTTCCGGCGAGCGCACTCGATCACTGACGAAGGAAACCCCGCCATTGAAGCCACGTGAACACCAAAACTCTCCATGCA
AGGCCCGTCGCGCACCTGGTACACCATCGTGATCTCCTTGTCGCTGGCCACGGCGGTAACGTGCTTGTTGGCGAAGCCTTGCGGGTGCTCTTGGTGCAGC
GCTGTCAGCTCGTGGAAGTGTGTCGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGCAGGTACTCTGAGATGGCCCAGGCCAGTCCGAAGCCATCGTACG
TGGACGTACCTCGGCCCAATTCATCGATAATCACCAGCGAGTGCTCCGTAGCCTTGTGTAGAATAGCCGAAGCCTCCAGCATTTCCAGCATGAACGTAGA
AACACCGCGTTGTTGAAGATCGCCCGCACCAACGCGCACCAACAGCTTGTCGAACACAGGCAGCCTCGCGACTTCTGCAGGCACAAAACTACCGATTTGT
GCCATCACAGCAATAGTGCCCAACTGACGGATGTAGGTACTCTTACCGCCCATATTAGGCCCGGTCACAAGCTGGAAGCGCGATTTCTCGCGCTCAAAGT
TGTAGTCGTTTGGAATGAAATCGACTCATCCTGCAGCTCCACACAAGGGTGGCGCGCACCTGTCAATATGACGCAGTCTCCATTTTTCTCCATAGTAGGG
CGACAATAGCCTGAGCCAGCATGGCATGCCGCGTGGGCGAATCCAAGCAGCACATCCAATTCTGCCAGTGTTGCAGTCGCAGCCTCGAGCACAGGTACGT
ATGTGCTAGCCACATCAATAGCCGCGTTCAGCAAGTGCGCTTGCCGCTCCTCGTATTCGCCGCGCACACGGCGGTACTCGGATGCCAGGCCCTTTAGCGT
CGTTGTAGTGAATTGGACTCCGCTCACGAGGACTTGGCAGATATGCACCTGTGGCATCTTGGACAACCGTGCCTCCTCCTTCTTGTTGGTAACACGGAAC
GCGAATCCGCGCACCTTGTCCTTCTCGCACTTGATCTCACCACCAATCGTATCGAGTGCATTGCGGTGTTCCTCCTCAATGTCCGCAAGGATGCCATCCC
ACTCCTCACGCAGCGCCTGGAGGTCCTTGTCATGCTTTGCGTTCACCACAAGGGTCGGACGGCTGTCCAGATCGACAACCTCCTTCACAAGCTCCGTGTA
GCCTTGCAGATCCGCAAGCTCCTTCTCCAGTGGAGCGGCAAACTTCTCCTTCACAAGAGCGGCCAAGGCCGTATCTCCACCCGCCTCCGTGTTTTTCAGC
AGCTTCAGCACGCGCGGCATGGCGCCGACAGCAGCATCGTACACACTACGAGGTCCGTGATCTTGGCATTTTTCTTGCGTTCAAGGCTGACCGCCAGTCG
CCCCAAGTCCGGCAGAGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAACGACGAGTCGTCCACAAAGAGCTGCACGAGGCTCTGTCTCGTCTCGATC
TGCTCGACATCCAGCAGCGGCTGTCGGATCCAGCGTTCCAGCAGACGGCGTCCCATGGGCGTCTTGCCACGGTTCAGGATCTCCAGCACGCTGCCTCCGA
ACCTCACCCCCGTGGTGGTAGCGCTGGGCTCCGGCAACAAGTTGAGCGACCAGACGGCAGCGCTGTCAAGCTGCATGGCTGACGCCAAGTTGCCCTGGCT
CAGTGTGTAGCAGCCAAAGGTATCGGCGTCAGCCATGACGCCCAGCGCCTCGATCAAACAGGCCAGTGAGCCCGCCGCCAGCTTAGACGAGAGCACGTCC
TGGTACTCGGCCATGGTACCGGCTCCCAGCAACCTGGAGACGTTGGTCTCGAGGCCGTTGGCGTCGCTGAAGAGCTGCTTCTTCCTGTACACTGCGGCCA
CGTCGTGGGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCGTCTGCTCCAGCTCCGCCGACAGGAAGCACGTGGAAGGCGCCAGCTG
CAACAACAGCGACTCGAGGTTGGCCAGCGCGCTCGAGTCGGAGAAGGAGAAGAGCACGAGCTCCCACTGCTTCCTGTCCTCGCCCGCCTGGCCCTTGACG
CATGACGCGCGGGCGCGCGGCCGCCGCACCGCCACGCCCACATGCTTCAGGTGCTTGTCGTTGCGGATTTGCAGTGCCACCTCGGCCTGCGCTTCGTCCA
GCAGCACCACGGACGAGTCGTCATCTTCGCGGTCGGCCATGGTCTCCTTTCGGACAATTCAAGAGTGAAGGTCGGTTCAATAGGCGCTTCCCGCGCTTTC
TCTGTCCGGGTTGAATGTCGCAATGTGACTTCTTCAAGAGAGAATGGGTCTTTTAACCTCGGACACTTTCGATTGCTCAGAATGGCGACGGATTGGCGTG
CGGAGTACGTGAAGGCGGCGGCGCTGGGGGACGCAGGAGACGCTACTGGGGACGTTACAGCGGTGCAACAGACGGGAAAGACGCCGGTGGGCGGTGTGCT
GGCGTTTCTGGACCTCCTGCTGACGCAGGAAGGCGGCGAGTGGTGGACCAAGCTGCAGAGGAAGGCCAGCGACGGCTGCCAAAAGTGATGGTCAAACAGT
GGACGCAAAGGACCAGAAGCAGCTGACGGCGCTCAAACACGGCTTGCAGCAGTGGGGACGACACTCGTGCTGCAACTGCCGCATCTGAACGCGTCTCTGA
GCAAGGAAACGGCCAGAGTGCGCGTGCTGCAGCTGCAGCTTGTGTGCCGTATGCTGTGCTATGCAGTGCTGATCAAGAAGAAGGAGAGGAAACTGCTGAA
GAAAGAGATTCAAGGATTAATGGACCGGGTGGCTCTGCTGCTGGATGCGGCGAACCCGCCGTCGCTGGCGGATGAAGACGCGGATGAACGCTCGCCGTTC
CAGGAGTTCCTGAAGCAGCAGTTGGCTCCCAGACTCGAGCTGCTGTTGCCAGAGTTGATGCAATATTTGCTGAAGGCATACGAGATGGAAGTGGAGGAGA
ACAAGGCCGACGAAGATGCGAAGGACTCCAACTTGCTCTTACCGACCGTGAGTGCTGGTGTTATCTCCCTGGTAGAGCTTTGTATGTGACGCTGATCACT
GATGTTTGTGGCTTGTGTGCAGTTGCTACCGGTGGTGAAGCCTCCTCAGTCACCTGCAGAGCTACCGACTTCTGTTGCTAGTGGCAATGGTAGTATTCTG
TCTGCGTTACGCCAAGAACGGCCAGCAAAGCGTGCTCGCCCCGAGGCTAGCGAGTTATTCAAGGAAGTCACGCTCCCGCATCAGTTGCAGCGGAGGCAGA
AGCAATCTCACCCTCGGAAGTCGAGACGGGTGACCAATAGCCACAGTAGCGGCGCAAGTAAAGCAGCCAGGCTCACTGCTGCGTGCGGCGGCTGGTACTA
CATCACTGCACGCACCAAGAAAGCTGGAATTTGCGGGCAAAACAGCTTTGTACGGCGCAGCTTCAAGTGCTAGACAACCTGGCCAATCGAACTTGCTGCG
TCGTGCCGCTAATCCGTCCGCGCCGAAGGGGCCTGCGCGCCCTTGCTCCAACGAGCAATGTCGGAGCGCTCTCACTTCCATGGCCGCCAAACGCCAATAG
GTTCATCGCCAGGTTCTGCTGCACAAGATGCCGGAGTCGCTACAGCTGGCAAAAAACAATCTCCTGGATCTGCATTACGGCGCTCGCAAACCACTTCATC
GGTAGTCATGCGAACTCCAGACAGACCGAAAAGAATGGCAGCACGAACCACGAGGCGCGTGCTCGTCGAAGCATCTCCTCCACTGCGCAGGCCCACCGCA
GCCGCTGTGCCTCGTCTTCTTCAGCCCAAGTCGTCTCGGCCAGGTTCCAACCCACCTCCTCTTTTCCGGTGACGGTGGCACGCGACCCGAATAATAGACA
ACGAAGACTTTTAAGTTCATCGGCATTGCCTAGCCATTACTATCTCGTGTGAGTGTTGTTGTCATCGCTGTCGCTGTCGCTGCCATATCCCACCAGTCCC
AGCGCCGCCGTATTCGGCTTCTCCTTCTTGGCAACAGGTGATGTGCTGGTGTCTTTTGGCTCGACCTTCTGCTTCTTATTGTCCGGTTGTTCCTTGGTGG
CATCACAACTCTCGGCAGCCTTCGTGCCAGCCTTACACGGCTTATCCTTCCCAGCCTTTCGCTTGGCCCGCACCACCACGACCGGGGTCTTCTTGCCTGC
CACCTTCACATCGTCTTTCACCGGATACTTTTGCAGGTGCTGCGCTGTAAGTCCCGTCCCAGCGGCGGTCTTAGGCGCACCGCGTGCCACCACTACACGC
ACCAAACACAACTCGTCGATCAACACCAACATTAAAGCCACCAATAAACCCTTCTGCCTTACGGAATTGCGCCAGGTCTTCTTCATGTTGCGTCTGGCGC
CTCCGTTGAACGTCGTCCTTCTTACTCTCCAAGTCCCGAATGTACTCGAACTCTTCCTCATCCAAACCCTTCGGGGGAGCTGTGCAGCCATAAAAAACGA
GTTCGAATTAATTACCGCAGCAACCACAGCCACAGATGCCACGCACCGAAGGGATTGTTCTTCTCCTTCCAGTCGCTGTCCTTCTGGTCTTTGCGCTCTT
GTAGCTGCTCGTACAGCGGCTTGTAACCTGCCGCGTCCTCTGCTCGAGGCGCGGGCGCCTCCGTCACGCGCTTCTCCTCCACATTGTCACCGAAGAGCTG
CAAACACGAGCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAAGTGGACACAAA
GCCCGCCAGAGACG